Molecular detection of fusarium circinatum, the causal agent of pine pitch canker
2007
Liao Tailin, Li Baisheng, Ye Jianren
Fusarium circinatum, the causal agent of pitch canker disease, causes several serious diseases of pines. The pathogen infects a variety of vegetative and reproductive pine structures at different stages of maturity and produces a diversity of symptoms. Long distance spread of the disease occurs when materials infected with the pitch canker fungus are transported to pest free-area. Preventing disease spread is important because once pitch canker becomes established in area there is no way to stop it from infecting and killing trees. The objective of our study was to establish a fast and reliable diagnostic test for the presence of F. circinatum. The oligonucleotide primers G1PG2 (5′2 GCGGTGTCGGTGTGCTTGTA23′P5′2 ACTCACGGCCACCAAACCAC23′) , derived from the differentiation of intergenic spacer ( IGS) regions within fungi , amplified a single 873 bp product from Fusarium spp. . The IGS DNA sequences of Fusarium spp. were gained from GenBank. Oligonucleotide primers S1PS2 (5′2CTTACCTTGGCTCGAGAAGG23′P5′2 CCTACCCTACACCTCTCACT23′) , derived from IGS DNA , amplified a product of 364 bp which was unique to F. circinatum. The nested2PCR using primers G1PG2 and S1PS2 identified F. circinatum from other Fusarium spp.. This PCR assay was proved to be highly sensitive with the detection limit of 5 ×10 - 3 pg•μL - 1 genomic DNA or 10 spores•(100 μL) - 1 H2O. The result indicates that the nested2PCR could successfully used to detect the presence of F. circinatum directly from infected plant tissue.
اظهر المزيد [+] اقل [-]