خيارات البحث
النتائج 161 - 170 من 22,078
Anatomic assessment of tendons and ligaments of palmar surface of metacarpus in Anatoly donkey and its comparison with horse النص الكامل
2015
Nazem, Mohammad Naser | Sajjadian, Sayed Mohsen
BACKGROUND: SDFT, DDFT and suspensory ligament are the most important tendons and ligament of the palmar aspect of the metacarpus that contribute to stability mechanism. OBJECTIVES: The purpose of this study was to describe the tendons and ligaments of the palmar surface of metacarpus in Anatoly donkey and compare them with those in horse. METHODS: 14 healthy Anatoly donkeys without lameness were selected to detect the tendons, ligaments and their accessories on the palmar surface of metacarpus in both left and right forelimbs after euthanasia. 4 horses were also selected and their tendons and ligaments in palmar surface of metacarpus were compared with those in Anatoly donkeys. RESULTS: DDFT and suspensory ligament in this region were similar in Anatoly donkeys and horses but SDFT in Anatoly donkeys had an accessory ligament in the palmar surface of the metacarpus that was originated from the deep fascia of carp after the carpal joint and was joined to the SDFT. CONCLUSIONS: This second accessory ligament of SDFT has not been observed in the studied horses and has never been reported in the related references. The results of this study can be used in to diagnose and treat lameness in Anatoly donkeys by radiologists and surgeons.
اظهر المزيد [+] اقل [-]Morphometric and Molecular Analysis of Gyrodactlus kobayashi in Carassius auratus (Linnaeus, 1758) النص الكامل
2015
Omidzahir, Shila | Ebrahimzadeh Mousavi, Hosseinali | Shayan, Parviz | Ebrahimzadeh Abkooh, Elahe | Mahmoodzadeh, Homayoun
BACKGROUND: Fish are constantly exposed to various pathogens and parasites in particular. Gyrodactylus from Platyhelminthes is an important monogenean ectoparasite that can cause disease and economical losses to cultured, wild, salt and fresh water and ornamental fish. Gyrodactylus appears to be one of the most prevalent parasites of ornamental fish especially in Cyprinids. Objectives: The present study aimed to identify morphometric and molecular characteristics of Gyrodactylus parasite on Carassius auratus (Linnaeus, 1758). Methods: Gyrocactylus parasites were isolated from skin, fins and gills of the fish with wet mount slide and were examined under light microscopy. The morphometrical characterization of Gyrodactylus specimens was performed using the measurements and drawings of opisthaptoral hard parts of the parasites. The molecular species description was based on polymerase chain reaction (PCR) of partial sequence of 5.8S region of ribosomal RNA (5´CGATCATCGGTCTCTCGAAC3´) and partial sequence of internal transcribed spacer2 (ITS2) of ribosomal RNA (5´TTAAGGAAGAACCACTAGAG3´). ResultS: Gyrodactylus species morphology identification was performed using Yamaguti (1961) identification key. The nucleotide sequences of the PCR products were compared with GenBank sequences. Conclusions: Based on morphometric analysis and sequencing, the Gyrodactylus specimens were described as Gyrodactylus kobayashi. Combination of molecular techniques with morphological analysis seems to be the best approach to identification of Gyrodactylus spices.
اظهر المزيد [+] اقل [-]Macroscopic and microscopic survey of sarcocystosis in ruminants Shahriar slaughterhouse, during 2012-2013 النص الكامل
2015
Alibeigi, Zohreh | Rahbari, Sadegh | Hoghooghirad, Nasser | Naisi, Soheyla
BACKGROUND: Sarcocystis infection is one of the most common zoonotic protozoon diseases caused by different Sarcocystis spp. Objectives: Due to the importance of this infection in public health, the infection rate of macroscopic and microscopic cysts in sheep and cattle of abattoir of Shahriar, was investigated. Methods: 138 slaughtered sheep and cattle were selected randomly and their esophagus, diaphragm, heart, tongue, masseter and intercostal muscles were separated. In order to find cysts, the samples were examined by two methods: direct observation for macroscopic cysts and finding microscopics cysts by smear dab, Giemsa staining and microscopic investigation for bradyzoites of parasite. Results: In slaughtered samples, there was no macroscopic cyst but microscopic cysts were positive in 93.48% of cattle and 86.95% of sheep by impression smear method. The results showed the significant difference between different muscles and microscopic cysts (p<0.05) .Heart and esophagus were the most infected and tongue was the least infected part. Infections in males were more than females in both sheep and cattle. There was no significant different in various ages of cattle, however, infection in sheep less than one year old, were higher than the other ages. ConclusionS: Due to the heavy Sarcocystis infection in meat of cattle and sheep and the importance of this parasite in public health, it is suggested to avoid eating raw and undercooked meat and conduct preventive measures such as closer inspection of carcasses and local or total removal of slaughtered in abattoir.
اظهر المزيد [+] اقل [-]The effect of plant extracts Prosopis farcta, Datura stramunium and Calotropis procera Against three species of Fish Pathogenic Bacteria النص الكامل
2015
Sanchooli, Narjes | Rigi, Mahin
BACKGROUND: The repetitive use of antibiotics in different fields (veterinary and medicine) improves the emergence and occurrence of the resistance phenomenon in pathogenic bacteria. Due to the problem of antimicrobial resistance, it is an urgent need to discover new drugs and alternative treatments for the control of bacterial diseases in aquaculture. OBJECTIVES: The purpose of this study is to investigate antibacterial effects of methanol and hexane extracts of medicinal plants Rattles (Prosopis farcta), datura (Datura stramunium L) and milkweed (Calotropis procera L), the major pathogenic bacteria of fish, including Aeromonas hydrophila, Yersinia ruckeri and Streptococcus iniae. METHODS: Extraction was performed using a rotary evaporator. To determine the minimum inhibitory concentration (MIC), the standard microdilution method (Dilution in broth) was used and the minimum bactericidal concentration (MBC) was determined based on MIC values obtained for each extract. RESULTS: The results showed that the effect of most potent extract, methanol extract obtained from fruit rattle on the three studied bacteria, with MIC and MBC are 25, 50mg/ml, respectively. The most sensitive bacteria to methanol and hexane plant extracts, is bacterium Streptococcus iniae and Aeromonas hydrophila and Yersiniaruckeri bacteria were resistant. The studied extracts had stronger antibacterial properties against gram-positive bacteria compared to gram-negative. CONCLUSIONS: According to the results, it seems that the use of methanol extract of Prosopis farcta fruit is effective for treatment of bacterial diseases in aquaculture.
اظهر المزيد [+] اقل [-]Generating Stable Cell Line for Producing Recombinant Phospholipase A2 of Honey Bee (Apis mellifera) النص الكامل
2024
Nabian, Sedigheh | Taheri, Mohammad | Alian, Sara | Shahbakhsh, Mahsa | Gerami Sadeghian, Abbas | Asadollahi, Zahra
BACKGROUND Honey bee venom contains complex compounds such as polypeptides, enzymes, and amines. One of the important components of bee venom is the phospholipase A2 enzyme, which is considered an important honey bee venom allergen and is also used to treat some diseases. This enzyme is found in other insects, arachnids, snakes, and mammalian cells, and its function is the hydrolysis of the second ester bond of glycerophospholipids and the release of fatty acids and lysophospholipids. Although transient transfection can produce recombinant proteins, stable cells are more suitable for high-scale production with economic efficiency.OBJECTIVES: The present study created a stable cell line to produce recombinant phospholipase A2 from honey bee (Apis mellifera) venom.METHODS: Plasmid cloning DNA vector containing phospholipase A2 gene was prepared by Macrogen Company. The recombinant plasmid was transferred to Chinese hamster ovary cells by heat shock method, and gene expression was carried out in a HamsF12 culture medium containing neomycin antibiotic. After increasing polyclonal strains containing plasmid, monoclonal clones were selected by limiting dilution. Then, monoclonal clones were propagated, the soup of the selected cells was collected and concentrated, and the protein expression was checked by sodium dodecyl-sulfate polyacrylamide gel electrophoresis test.RESULTS: The results of electrophoresis, which was performed to confirm the expression of the phospholipase A2 gene in the cell soup, showed a band with a molecular weight of 20 kilodaltons, which confirms the creation of a stable cell line for the production of recombinant phospholipase A2 honey bee venom.CONCLUSIONS: After the transient transfection of the plasmid containing this gene, several cells undergo recombination due to having repair mechanisms and putting the desired gene along with the antibiotic resistance gene in their genome. These cells can be selected and propagated by adding antibiotics to the culture medium.
اظهر المزيد [+] اقل [-]Association of Brisket Board Height and Neck-Rail Position in Freestall Barns with Some Comfort Indices in Dairy Cows النص الكامل
2024
Kohansal, Fatemeh | Ebrahimi, Amir Hosein | Faezi, Marzieh | Mohammadnia, Ahmadreza
BACKGROUND: In free stalls, factors related to the surface and dimensions of the stall affect how the cows rest and comfort. The brisket board and the neck rail are the most controversial parts of the free stall in Iran's dairy farms, that can affect the stability of the stall and its lifespan, while improper use of these structures has led to significant discomfort for cows, causing substantial issues including lameness and hock, knee and withers lesions.OBJECTIVES: This study aims to investigate Brisket boards and neck rails usage and measures in freestall barns and assess its possible impact on some comfort indices in dairy cows.METHODS: Nine dairy farms with over 100 milk cows and freestall barns were selected using the Dairy Farmers of Canada protocols by a convenience sampling method. Horizontal, vertical, and diagonal distances of the neck rail, the presence or absence of brisket boards, and the brisket board height from the bedding were measured. The locomotion score based on a five-point scale as well as hygiene, knees, hocks, and withers scores were recorded. The correlation was evaluated using the Spearman correlation test and Pearson’s correlation test.RESULTS: In 68.3 % of the freestall barns, the brisket boards were at the bedding level or were not used at all; however, the mean brisket board height (11.2±10.8) was not significantly different from the standard height value of 10 cm (P>0.05). The vertical distance of the neck rail (120.4±10.4 cm) was significantly different from the standard values. The median of withers and locomotion scores were consistent among all farms. At the farm level, the median knee, hygiene, and hock scores did not show a significant correlation with the mean of neck rail measures and brisket board height (P>0.05). Also, the median locomotion score did not show a significant correlation with the mean horizontal distance of the neck rail at the individual freestall barn level (P>0.05). However, a significant correlation between the mean of knee scores and vertical distance of the neck rail at the farm level, and between the mean of locomotion score and horizontal distance of the neck rail at the individual freestall barn level were reported.CONCLUSIONS: An increase in the mean vertical distance of the neck rail is associated with an increase in the median knee scores, while an increase in the mean horizontal distance in each barn was associated with an increase in the median locomotion score, indicating the potential impact of these measurements on cow comfort. However, further research using a larger sample size is needed.
اظهر المزيد [+] اقل [-]Identifying Corynebacterium pseudotuberculosis in Sheep of Kurdistan Province in Iran by Culture and Polymerase Chain Reaction and Determining the Antibiotic Resistance of its Isolates النص الكامل
2024
Ataei Kileh Golan, Jamil | Derakhshan, Safora | Sharifi, Aram | Nayeri Fasaei, Bahar | Zahraei Salehi, Taghi
BACKGROUND: Corynebacterium pseudotuberculosis is the etiological agent of caseous lymphadenitis (CLA), a chronic and very common disease in sheep and goats, which can lead to severe economic losses in the livestock industry.OBJECTIVES: This study aims to investigate the prevalence of CLA in sheep in Kurdistan province of Iran using phenotypic and molecular methods, and assess the antibiotic resistance of isolated Corynebacterium pseudotuberculosis.METHODS: In this study, from September to March 2022, 270 samples of skin abscesses were collected from sheep in livestock farms of Kurdistan province. Immediately, using the cold chain system, the samples were transferred to the microbiology laboratory of the Faculty of Medicine at Kurdistan University of Medical Sciences. Identification of isolates was done using biochemical tests and polymerase chain reaction (PCR) method. The antibiotic resistance of the isolates was examined using the Kirby-Bauer disk diffusion method.RESULTS: Based on biochemical tests, out of 270 samples, 82 suspected to have Corynebacterium pseudotuberculosis. Out 82 samples, the presence of bacteria was confirmed in 76 samples by the PCR. The antibiotic sensitivity test showed that the isolates had high sensitivity to doxycycline and ceftriaxone and high resistance to streptomycin and kanamycin.CONCLUSIONS: The CLA has a high prevalence in sheep in Kurdistan province. According to high resistance rate of Corynebacterium pseudotuberculosis to streptomycin and kanamycin, it recommended to avoid treatment of CLA cases with these antibiotics.
اظهر المزيد [+] اقل [-]Evaluation of Skin Repairing and Antifungal Properties of Alcoholic Extract of Laleh abbasi (Mirabilis jalapa) Leaf on Induced Wounds in Laboratory White Rat Model النص الكامل
2023
Zamani Raad, Behran | Mardjanmehr, Seyed Hossein | Sasani, Farhang | Khosravi, Alireza | Gharagozlou, Mohammad Javad
BACKGROUND: Based on the historical and recently published documents, it has been demonstrated that Mirabilis jalapa as a herbal medicine may be used as remedies for various health problems included wound healing purposes.OBJECTIVES: The present study aimed to investigate the effect of ethanolic extract of Laleh abbasi green leaf on healing open wounds induced by skin puncture in the back of rats.METHODS: Collecting and drying Laleh abbasi leaves, leaf extracting through Soxhlet procedure, analyzing the extract via gc / ms method, and preparing eucerin-based extract ointment were done according to recommended routine procedures. Herein, we recruited 40 male rats that were randomly divided into five groups of eight, namely the control, phenytoin treatment, eucerin, 5% eucerin extract, and 7.5% eucerin extract ointment treatment groups. Skin puncture and application of ointments on the induced wounds were carried out. Subsequently, tissue samples were taken on days 3, 7, 10, and 14, followed by which histological slides were prepared and stained with H&E and Masson’s trichrome staining methods. In vitro mycological studies were conducted using opportunistic fungi, including Candida, Mucor, and Aspergillus species.RESULTS: Based on the macroscopic evaluations of the wound healing process and microscopic assessments of tissue samples stained with Harris H&E and Masson’s trichrome methods, the groups treated with eucerin-based ointments containing ethanolic extract of Laleh abbasi leaf had statistically significant positive wound healing responses compared to the other groups. However, the 7.5% ointment group showed statistically better responses compared to the 5% ointment group. The data obtained in the present preliminary experiment on rat model indicated that the extract could facilitate the wound healing process in terms of healing parameters, such as accelerating epithelium repair, creating a favorable inflammatory reaction, angiogenesis, fibroplasia, and collagen precipitation. The antifungal effects of ethanolic extract of Laleh abbasi leaves on Aspergillus fumigatos, fusarium, Candida albicans and Candida cruzei were demonstrated in vitro using saboro dextrose agar medium.CONCLUSIONS: According to the findings of this experimental study and the findings of other researchers, it can be concluded that ethanolic extract from Laleh abbasi leaves is of healing and antifungal properties.
اظهر المزيد [+] اقل [-]Comparison to Methods; Serum Antibody ELISA and Fecal Nested-PCR to Diagnose Mycobacterium avium Subspecies Paratuberculosis Subspecies Infection in Cattle النص الكامل
2023
Kolivand, Ali | Haji Hajikolaei, Mohammad Rahim | Nouri, Mohammad | Khosravi, Mohammad | Gharibi, Dariush
BACKGROUND: Mycobacterium avium subspecies paratuberculosis is the cause of a common disease in dairy herds. Early diagnosis of paratuberculosis infection can improve Johne’s disease control programs.OBJECTIVES: This study aimed to compare the sensitivity, and specificity to methods; blood serum ELISA and stool Nested-PCR for the detection of Mycobacterium avium subspecies paratuberculosis infection in dairy cattle.METHODS: A commercial ELISA kit was used to perform the absorbed ELISA test, which was conducted after exposing serum samples to Mycobacterium phlei antigens to limit cross-reactions. Nested-PCR test was performed using nucleotide sequences related to specific MAP gene fragments, i.e. IS900.RESULTS: As a result of the ELISA antibodies kit, out of the total 2203 serum samples, 112 samples were positive (5.08 %) and 2091 samples were negative (94.92 %). The results of Nested-PCR tests of rectal feces showed that out of 59 cows with the positive results in serum ELISA, 47 (79.66 %) samples were positive and 12 (20.34 %) samples were negative. Moreover, out of 31 cattle with a negative result on the ELISA test, 15 (48.38%) and 16 cattle (51.62 %) had positive and negative results, respectively, on the nested PCR tests of the feces samples.CONCLUSIONS: Due to the low sensitivity of PCR compared to ELISA, the positive and negative predictive values, and the accuracy of ELISA test, as well as the high cost and time-consuming nature of PCR and the need for more and more complex facilities than ELISA, the authors concluded that ELISA is a more suitable method for screening and epidemiological studies than PCR.
اظهر المزيد [+] اقل [-]Radiographic Evaluation of Effective Quantitative Criteria in Diagnosis of Laminitis before and after Trimming in Healthy Horses النص الكامل
2023
Soroori, Sarang | Tavakoli, Amir | Akbarein, Hesameddin | Bonyadi, Mojtaba | Shateri Amiri, Banafshe
BACKGROUND: Horses are economically and emotionally valuable animals in various activities, especially sports. Thus, paying attention to their limb's health and conformation is vital. One of the most common diseases in the limbs of horses is laminitis. Horses with this condition suffer from lameness because it affects laminar tissue. In addition to clinical signs, radiographic criteria are essential for identifying this disease.OBJECTIVES: It is predicted that examining the effectiveness of quantitative radiographic criteria of the hoof can be helpful in the diagnosis of laminitis. Therefore, in this study, five quantitatively effective factors were investigated before and after hoof trimming to determine the changes in the radiographic diagnosis of laminitis.METHODS: A total of 11 clinically healthy horses were used in the current study. Using Marco DICOM Viewer software, lateral and dorsopalmar radiographs from the hoofs of both forelimbs were evaluated for the diagnosis of laminitis using effective quantitative criteria. Using SPSS version 24, paired T-tests were used to analyze quantitative data. P≤0.05 was considered significant.RESULTS: According to the results of this study, there were no significant differences between the right and left forelimbs after hoof trimming. On the other hand, significant differences were observed in the four following criteria: dorsal thickness between the dorsal surface of the third phalanx and the dorsal surface of the hoof, the angle between the dorsal surface of the third phalanx and the dorsal surface of the hoof, sole thickness, and the ratio of the third phalanx dorsal surface thickness to its maximum length in each forelimb before and after hoof trimming.CONCLUSIONS: During the radiographic examination, the hoof should be positioned in a standard way to diagnose laminitis accurately. However, if the hoof is not trimmed or not trimmed properly, it can interfere with laminitis diagnosis.
اظهر المزيد [+] اقل [-]