BACKGROUND: Brownbanded Bamboo sharks (Chiloscyllium punctatum) is one of the cartilaginous fish that lives in the Persian Gulf. OBJECTVES: The purpose of the present study is to study the effects of thyroid hormone on reproductive system of this specious. METHODS: In this investigation, 36 individual of Brownbanded Bamboo sharks (Chiloscyllium punctatum) in both autumn (before reproduction) and spring (period of reproduction) seasons were caught from Dervish’s Creek located at the northern of Persian Gulf. After weighing, biometry, sex determination and the numbering of sharks, (the sex is determined through clasper which is observed in male and not in female), ELISA was used to measure serum thyroid hormone concentrations. RESULTS: The results showed that T3 and T4 hormones were increased dramatically in the reproductive season compared with the non-breeding season (p<0.05). On the other hand, by classifying the sharks into different groups, we found that the levels of thyroid hormone were higher in the blood of larger sharks compared with the smaller ones (p<0.05). CONCLUSIONS: It is probable that T4 hormone levels will increase dramatically for the development of eggs in the female shark.

BACKGROUND: Essential oils as growth stimulant play an important role in improving intestinal microflora and morphological properties and immune system in broiler chickens. OBJECTIVES: The aim of this study was to investigate the effects of Artemisia sieberi oil on intestinal morphology, secum microflora and immune system in broiler chickens. METHODS: Two hundred day-old broiler chickens (Ross 308) were allocated to 5 treatments, 4 replications with a completely randomized design during 42 days of age. Experimental treatments consisted of control (basal diet) or basal diets containing different levels of Artemisia sieberi oil (100, 200 and 300 mg/kg) and 600 mg/kg flavophospholipol antibiotic. On day 42 days of age, intestinal morphology and microflora population and immune system were evaluated by measuring the weight of bursa of fabricious and spleen and antibody production. Results: The results indicated that the highest lactobacillus count and the lowest Escherichia coli count of the caecum was found by inclusion of 300 mg/kg Artemisia sieberi oil in the diet (p<0.0001). The antibiotic and Artemisia sieberi oil treatments showed higher villus height in the duodenum compared with control group (p<0.01). Artemisia sieberi oil and antibiotic supplementations significantly decreased epithelial thickness and goblet cell number of the small intestinal compared with control group (p<0.05). The dietary supplementation did not significantly affect the crypt depth and villus height to crypt depth ratio in small intestine. The level of 300 mg/kg Artemisia sieberi oil significantly increased antibody titration against Newcastle disease virus (p<0.01). Conclusions: Adding Artemisia sieberi oil at levels of 300 mg/kg to broiler chicken diets can improve gut microflora (as measured by changes in populations of Escherichia coli and lactobacillus).

BACKGROUND: Theileriosis is a blood protozoan disease with high mortality in cattle in tropical and subtropical regions of the world. Several studies were conducted to identify Theileria species in infected cattles and vector ticks by microscopic examination. However, microscopic technique has lower sensitivity compared to molecular method.                  OBJECTIVES: This study was carried out to identify Theileria species and its carriers in cattles of Yazd city, sing semi nested PCR. METHODS: Between June to September of 2012, 100 EDTA blood samples and 249 ticks were collected from Holstein breed with no history of vaccination against the ileriosis in Yazd area. The collected samples were transported to the laboratory, then prepared the blood smears and stained with Giemsa method. Also, the collected ticks were separated into 50 tick pools, according to their species. Then their salivary glands were removed using stereomicroscope in 0.85% saline. DNA of blood and salivary glands was extracted using a commercial kit and analyzed by Semi-nested PCR. PCR-RFLP was also used to differentiate Theileria lestoquardi from Theileria annulata in positive samples of ticks. RESULTS: Ring forms of Theileria spp. were found in 4 (4%) of blood smears. All ticks were Hyalomma a.anatolicum. Results of PCR were indicated that 11 (11%) of blood samples and three pools of tick’s salivary glands were infected with Theileria. Theileria annulata were only detected in all positive samples by Semi-nested PCR. The results of PCR-RFLP using MspI enzyme showed that the tick’s salivary glands were negative to Theileria lestoquardi infection. CONCLUSIONS: Based on the results, it is concluded that Theileria annulata and Hyalomma a.anatolicum are important agent and vector tick of tropical theileriosis in dairy cattles of Yazd area.

BACKGROUND: Newcastle disease is one of the most serious viral diseases in the poultry worldwide. OBJECTIVES: Since the traditional strategies have been hardly effective in controlling the disease, the purpose of this study was to introduce new methods for early and rapid diagnosis of Newcastle. The present study helps to reduce further damage to the poultry industry. METHODS: RNA extraction was performed, using RNease mini kit, according to the manufacturer’s instructions. Extracted RNA with 68.23×109 copy numbers was prepared as serial dilutions of 100 μL for RT-PCR and RRT-PCR reactions. RRT-PCR and RT-PCR were performed, using commercial kit and RNease mini kit, respectively.  RESULTS: Results showed that amplification was done according to prepared dilution equal 10-34 for RRT-PCR reaction and a visible band observed on 1.5% Agarose gel up to 10-20 for RT-PCR reaction. Based on the results observed, RRT-PCR and RT-PCR reactions are able to detect 10-34 and 10-20 copy numbers of primary sample, respectively. CONCLUSIONS: The sensitivity of RRT-PCR reaction is almost twice compared with RT-PCR reaction, also RRT-PCR reaction is able to diagnose Newcastle disease virus in infected samples with 10,000 copy numbers of the RNA virus less than RT-PCR.

BACKGROUND: Eimeria infection is an important part of protozoal infection in ruminants which causes economic lost in animal husbandry of Iran and worldwide. Therefore it is important to implement effective control programs on the prevalence and diversity of Eimeria species in livestocks. OBJECTIVES: This study was aimed to determine prevalence and Eimeria species diversity in dairy cattle with different age groups under industrial management. METHODS: The present study was carried out in industrial cattle husbandry of Kangavar suburban of Kermanshah province, Iran, from spring 2011 to 2012. A total of 307 fresh fecal samples were randomly collected from the rectum of examined animals. The fecal specimens were subjected for flotation technique and collect Eimeria oocysts. The intensity of infection was determined using McMater method. Eimeria species diversity and frequency was also determined by using oocyst sporulation technique in 2.5% potassium dichromate. RESULTS: The overall prevalence was 31.92% (98 out of 307). The highest prevalence was found in dairy cattle (37%) with 1-3 years old. There was no significant difference between prevalence and different age groups. The highest frequency was significantly in spring (41.66%). The intensity was variable in examined animals which ranged from 3.18×103 to 2.71×105. There was no significant difference between the prevalence and intensity in all age groups. Fecal consistency findings revealed that the highest infection was significantly in dairy cattle with normal fecal consistency in all age groups. According to Laboratory identification, a number of seven Eimeria species were detected in all infected animals. The most common specie was E. zuernii (28.25%) in 5% dairy cattle (1-3 years-old) in spring (30%) and summer (30%). There was significant association between frequency of Eimeria infection and each season during the course of the study. All infected cattle had mixed infections with two (42.85%) and three (3.15%) species of Eimeria. CONCLUSIONS: The results of this study indicated that cattle Eimeria infection was a problem in dairy cattle of industrial farms in the region. Attention should be paid within seasonal infection in young cattle to avoid probable clinical coccidiosis, particularly in farms with poor hygienic conditions and no prophylactic treatments.

BACKGROUND: Despite the use of prophylactic chemotherapy and vaccination, coccidiosis is still one of the most devastating diseases in poultry industry. Understanding the immune mechanism helps researchers to prevent this parasitic infection more effectively. OBJECTIVES: The purpose of this study was to evaluate the antibody response in chickens, induced by a live attenuated vaccine (Livacox Q), before and after challenge, by means of ELISA. METHODS: One hundred and twenty one-day-old male Ross 308 broiler chicks were randomly divided into 4 groups of 30 birds. In 4th day of age, half the birds were orally vaccinated. The challenged groups received the infective dose at 14th day of age via oral administration. Besides recording weight gain, lesion score and oocyst count in 21st day old birds, humoral immunity was assessed by means of ELISA on serum samples taken from 7 and 21day-old birds. Results: Three days post vaccination, the average of optical density (OD) showed significant difference between vaccinated (0.553) and unvaccinated (0.686) birds (p≤0.05). In 21 day-old birds, the OD of unvaccinated-unchallenged (negative control) groups (0.331) differed significantly with vaccinated-unchallenged (0.663) birds. The average of lesion score in vaccinated-challenged birds (2.22) showed significant dissimilarity with unvaccinated-challenged groups. No difference and correlation were observed in comparing average of weight gain and oocyst count with serum optical density among treatment and control groups. ConclusionS: The results indicated that ELISA can be used for evaluating immunity uniformity of a flock after vaccination. Besides inducing antibody responses comparable to challenge with wild oocysts, vaccination with live attenuated coccidiosis vaccines may have inhibitory effects in intestinal lesion scores which are responsible for pathogenesis and economic loss during coccidial infections.

BACKGROUND: Brucellosis is one of the most important zoonosis that is prevalent among human and animal. Today, a large percentage of animal and human population suffer from its side effects. OBJECTIVES: The purpose of the present study was to estimate the prevalence of anti-Brucella antibodies in flock- and animal-level in districts of south of Kerman province. METHODS: In this cross-sectional study, 300 herds of 7 districts in the area were selected randomly; 10 samples of sheep and goats in each flock were randomly selected. Out of 3000 samples, 2952 samples were examined using Rose-Bengal test; Wright and 2-ME tests were done on positive samples. Descriptive statistics and logistic regression in Stata 11.2 were used to analyze the data. RESULTS: The seroprevalence of anti-Brucella antibodies in animal- and flock-level was 6.4 and 25.3 percent, respectively. The chance of being infected in sheep was 2.12 times of goats. CONCLUSIONS: The prevalence of Brucella was considerably high in animal- and herd-level in this area. It is necessary to empower Iran Veterinary Organization in financial aspects to control this infection.

BACKGROUND: Fibroblasts are one of the important cells in wound healing. These cells create a proper bed for keratinocytes migration and wound contraction.Wound healing in distal limb of horses has complications, such as formation of exuberant granulation tissue (EGT). The main factor in this problem is overgrowing of fibroblasts. ObjectiveS: The purpose of the present study was to compare fibroblast growth curve in isolated skin from horses’ neck and distal limb. Methods: 5 horses with normal hematological and clinical signs were selected. Two samples of full thickness of skin were taken from the neck and lateral metacarpal region of each horse asseptically. Then the samples were washed with PBS minced and placed in ventilated flask 25 cm2. After attaching samples to flask, 5 ml culture medium(RPMI-1640 with 10% FBS) were added and the flask was placed in an incubator at 37°c in 5% CO2. After leaving a sufficient number of cells from tissues adhered to the bottom of the flask, the cells were passaged to a new ventilated flask. After growth and proliferation of cells, they were passaged again and a suspension of cells in culture medium (10000 cells/ml) was maked. To each cell of a 24-well plate, one ml of this suspension was added. After 48 hour, cells of 3 well were detached with tripsin daily, counted and viability determinted within 8 days. Results: There was no significant difference between viable cells number but there was significant difference in viability percent of cells in neck and distal limb. The mean of population doubling time (PDT) for fibroblasts of neck is 31.73 hours and for fibroblasts of distal limb is 26.4 hours. This difference was not significant. ConclusionS: With regard to different viability percentage, it seems that the appoptosis in fibroblasts of neck skin is more regular than distal limb skin.

BACKGROUND: Reptiles, especially turtles that inhabit both on land and water, have made some special adaptations. Many people keep turtles as pets. Therefore, the anatomical knowledge of turtles should be more carefully evaluated and used for therapeutic purposes. One of these turtles is European pond turtle (Emys orbicularis). Most of vital systems are enclosed by the carapace and the plastron so it cannot be examined customarily by clinicians. The noninvasive diagnostic imaging techniques provide detailed information concerning these organs. OBJECTIVES: This study was conducted to give complete topographic information and knowledge about the position of the non respiratory organs of the coelomic cavity in the European pond turtle using Computed Tomography (CT) and usual anatomic methods. METHODS: 10 adult turtles (5 female, 5 male) were selected. All scans were obtained on a two detector scanner. In anatomical study three female and three male turtles were dissected. Two other female and male turtles were sectioned transversely. RESULTS: The results showed some differences in the position of the organs including stomach, gall bladder, liver and heart with those of other species. Moreover, the topography of the organs is described in retracted and protruded neck in this article. Retraction of the neck had an influence on the position of the organs such as oesophagus, stomach, liver and heart. CONCLUSIONS: The general morphological features of the non respiratory organs of the coelonic cavity of European pond turtle were examined by CT images and macroscopically in this study. Significant differences were found compared with other species.

BACKGROUND: Fish are constantly exposed to various pathogens and parasites in particular. Gyrodactylus from Platyhelminthes is an important monogenean ectoparasite that can cause disease and economical losses to cultured, wild, salt and fresh water and ornamental fish. Gyrodactylus appears to be one of the most prevalent parasites of ornamental fish especially in Cyprinids. Objectives: The present study aimed to identify morphometric and molecular characteristics of Gyrodactylus parasite on Carassius auratus (Linnaeus, 1758). Methods: Gyrocactylus parasites were isolated from skin, fins and gills of the fish with wet mount slide and were examined under light microscopy. The morphometrical characterization of Gyrodactylus specimens was performed using the measurements and drawings of opisthaptoral hard parts of the parasites. The molecular species description was based on polymerase chain reaction (PCR) of partial sequence of 5.8S region of ribosomal RNA (5´CGATCATCGGTCTCTCGAAC3´) and partial sequence of internal transcribed spacer2 (ITS2) of ribosomal RNA (5´TTAAGGAAGAACCACTAGAG3´). ResultS: Gyrodactylus species morphology identification was performed using Yamaguti (1961) identification key. The nucleotide sequences of the PCR products were compared with GenBank sequences. Conclusions: Based on morphometric analysis and sequencing, the Gyrodactylus specimens were described as Gyrodactylus kobayashi. Combination of molecular techniques with morphological analysis seems to be the best approach to identification of Gyrodactylus spices.