Effect of nucleotide polymorphism of sdw1/denso gene on the variability of the main economically valuable traits of winter barley | Влияние нуклеотидного полиморфизма гена sdw1/denso на изменчивость основных хозяйственно-ценных признаков озимого ячменя

English. The work purpose was to compare the allelic polymorphism of sdw1/denso gene with the results of a phenotypic assessment of economically valuable traits of winter barley to determine the prospects of using a system of functional markers for marker-assisted breeding of high-productive barley varieties. Field observations were performed in the Rostov region in 2016–2018. Molecular screening of the specimens was carried out in St.Petersburg. The objects of the study were 96 varieties of barley of various ecological and geographical origin of domestic and foreign breeding, contrasting in morphological and biological traits. Genomic DNA was isolated from barley leaves according to a standard procedure using a STAB buffer. The polymerase chain reaction was carried out in a GeneAmp PCR system 9700 thermocycler; visualization of amplification products was carried out by electrophoresis in a 1.3% agarose gel with the addition of a 1% solution of ethidium bromide in 0.5 x (dilution of the concentrate 1:10) TBE-buffer (Tris borate EDTA). To detect alleles at sdw1/denso locus, HaeIII CAPS marker was used, detecting SNP in the second intron of the gene. The sequence of allele-specific primers was Hv20ox2F_1: GCTGATTAACTGGGACACATA; Hv20ox2R_1: GGTGCTAATGTCGCTATGTC. We used a molecular weight marker 100bp DNA Ladder (fragment range of 100–1000 bp, the step of 100 bp). Under the field conditions, resistance to lodging, weight of 1000 grains, and protein content in the grain were evaluated. Among 15 varieties with an identified dominant allele, 13 varieties of European origin formed a large filled grain with a weight of 1000 grains of 41.3–55.4 g. The results of a two-factor analysis of variance to identify the association of the influence of sdw1/denso gene alleles and the origin of the variety on the weight of 1000 grains showed that the sdw1/denso alleles, as well as the origin of the varieties, affected this important yield indicator, however, both factors are not related to each other (p = 0.698). Thus, the dominant (mutant) allele of sdw1/denso gene detected using the used CAPS marker can be recommended for the selection of more productive genotypes.

Russian. Выполнено сопоставление аллельного полиморфизма гена sdw1/denso с результатами фенотипической оценки хозяйственно-ценных признаков озимого ячменя для определения перспективы применения системы функциональных маркеров (геноспецифичных) для селекции высокопродуктивных сортов. Полевые наблюдения выполняли в Ростовской обл. в 2016–2018 гг. Молекулярный скрининг образцов проводили в Санкт-Петербурге. Объектом исследований служили 96 сортов ячменя различного эколого-географического происхождения отечественной и зарубежной селекции, контрастных по морфобиологическим признакам. Геномную ДНК выделяли из листьев ячменя по стандартной методике c использованием СТАB-буфера (цетилтриметиламмонийбромид). Полимеразную цепную реакцию проводили в амплификаторе GeneAmp PCR system 9700; визуализацию продуктов амплификации – с помощью электрофореза в 1,3%-ном агарозном геле с добавлением 1%-ного раствора бромистого этидия в 0,5x (разведение концентрата 1:10) TBE-буфере (трисборат ЭДТА). Для определения аллелей в локусе sdw1/denso использовали CAPS-маркер HaeIII, выявляющий SNP во втором интроне гена. Последовательность аллель-специфичных праймеров – Hv20ox2F_1: GCTGATTAACTGGGACACATA Hv20ox2R_1: GGTGCTAATGTCGCTATGTC. Использовали маркер молекулярного веса – ДНК 100bp DNA Ladder (диапазон фрагментов 100...1000 п.н., шаг 100 п.н.). В полевых условиях оценивали устойчивость к полеганию, массу 1000 зерен, содержание белка в зерне. Из 15 сортов с идентифицированным доминантным аллелем, 13 сортов европейского происхождения формировали крупное, хорошо выполненное зерно с массой 1000 зерен 41,3…55,4 г. По результатам двухфакторного дисперсионного анализа аллели sdw1/denso, как и происхождение сортов, влияют на этот важный показатель урожайности (р меньше 0,001), однако оба фактора не связаны между собой (р=0,698). Доминантный (мутантный) аллель гена sdw1/denso, выявляемый с помощью использованного CAPS-маркера, может быть рекомендован для отбора более продуктивных генотипов.