Refine search
Results 461-470 of 17,777
Histometrical study of ovarian follicles of immature mice treated with methylphenidate
2015
Fazelipour, Simin | Adhami Moghadam, Farhad | Davudi, Parivash | Tootian, Zahra | Assadi, Fardin
BACKGROUND: The main part of ovary is consisted of follicles which certain drugs may cause change in them. OBJECTIVES: The purpose of this study was to investigate the effects of Methylphenidate on ovarian follicle of mice, treated by Ritalin before puberty. METHODS: 40 immature female mice at 3 weeks of age were divided into 4 groups, consisting of one control and 3 experimental groups. The experimental groups were gavaged by 2, 5 and 10 mg/kg methylphenidate respectively and the control group received only distilled water with the same method for 60 days. At the end of the experiment, the mice were weighed and then the serum levels of FSH and LH were assessed and structural changes of ovarian follicles and corpora lutea were studied. RESULTS: The mean difference of body weight in experimental groups compared with the control group which showed a significant reduction (p<0.05). In experimental groups compared with the control group, a significant reduction in pre enteral, enteral follicles, corpora lutea and a significant increase in atretic follicles were observed (p<0.05). CONCLUSIONS: Ritalin intake for a long period may increase the number of atretic follicles and decrease corpora lutea, so subsequently results in reduction of the growth of follicles and oocytes as well as inducing the atypical appearance of the cells in the luteinized cells.
Show more [+] Less [-]The effect of colicin on E. coli K99 in mice
2015
Golestan, Fatemeh | Tahamtan, Yahya | Moazamian, Elham
BACKGROUND: K99 pilus antigen is one of the major adherence factors found on enterotoxigenic Escherichia coli (ETEC) of neonatal calves. It causes severe diarrhea in newborn calves via the production of heat-stable enterotoxin (STa).With increasing concern over the spread of antimicrobial resistance, the development of alternative to conventional antibiotics such as colicin is urgently needed. Colicin is an antimicrobial peptide produced by one strain of E. coli to suppress the growth of other strains of E.coli. Objectives: The purpose of this study was to investigate the control of E.coli k99 and the efficacy of colicinogenic E.coli (CEC) in adult mice. Methods: The mice, used antibiotic were divided into four groups. The first group did not receive any inoculation. The second group was fed just with 0.5 ml colicin solution. The third group was fed just with 0.5 ml E.coli k99 suspension. The fourth group was first fed by 0.5 ml E.coli k99 suspension immediately after oral administration of CEC suspension. Fecal samples of mice in four groups were taken 1, 2, 3, 4, 5, 6 and 7 days after inoculation and colony forming units (CFUs) were monitored per gram feces. ResultS: The results showed that CEC has inhibitory effect against E.coli k99. There were observed significant differences between the amounts of E.coli k99 recovered from the feces of mice in fourth group with the amount of E.coli k99 recovered from the feces of mice in third group. Conclusions: The data presented here support this claim that CEC plays a significant role against E.coli k99. Furthermore, the study suggested colicin warrants further evaluation as a potential alternative to conventional antibiotics for use to control of E.coli k99.
Show more [+] Less [-]Construction of mutant WbkA gene in Brucella abortus S19 by overlap extension PCR
2015
Naserli, Solmaz | Zahraei salehi, Taghi | Nayeri fassayi, Bahar | Saeedinia, Alireza | Ashrafi tamami, Iraj
BACKGROUND: Causing site direct mutation can be one of the efficient methods to evaluate the characteristics and properties of various genes. Brucellosis is the most common zoonotic infectious disease that would cause great economic losses. Thus, recognition of pathogenic and immunogenic factors in the genus Brucella can lead to control this health problem. Objectives: Considering the importance of site direct mutation in identification of genome structure and numerous ways to achieve this goal, Overlap Extension PCR is introduced as an improved technique for the removal and replacement of the gene target. Methods: For this study, with two-step PCR using specific primers, upstream and downstream fragments from target gene and antibiotic resistance cassette from plasmid pET28a (+), were reproduced and were connected to each other. The resulting fragment was cloned in specific position of pBluescriptIISK(-) plasmid by the restriction enzymes. Then, the construction was transferred into the genome of Brucella abortus by electroporation method. Results: Fusion PCR product was obtained without any change in the nucleotide sequence and then it was cloned into pBluescriptIISK (-) plasmid, finally the construction was replaced and the target gene was deleted. Conclusions: The results of this study show that the Overlap Extension PCR is an optimized and modified technique to create mutations in the bacterial genome structure and can easily be used in the family Brucella.
Show more [+] Less [-]Evaluation of abnormal heart sounds using phonocardiography and comparing them with echocardiographic findings in dog
2015
Tambrchi, Yara | shirani, dariush | soroori, sarang | masoudifard, majid
BACKGROUND: One of the most important heart diseases in dogs is valvular insufficiency, which can be evaluated by diagnosis ways such as phonocardiography, echocardiography, etc. OBJECTIVE: The purpose of the current study was to evaluate of valvular insufficiencies with phonocardiography and echocardiography and using phonocardiography technique in detection of cardiac valvular disease in practice. METHODS: This survey was done on 180 five-year-old dogs which 30 of them had valvular insufficiency. They have been referred to radiology section and echocardiography technique was used after listening to heart sounds and recording heart murmur and surveying by phonocardiography. The type and location of valvular insufficiency was diagnosed by phonocardiography and then echocardiography was used, the results from both techniques was compared afterwards. RESULTS: In all of these 30 dogs, murmur was systolic and mitral insufficiency and mitral regurgitation were diagnosed by phonocardiography. using echocardiography, the mitral insufficiency was confirmed in 28 dogs, one of them has been diagnosed to have tricuspid inssufiency and pulmonary stenosis in addition to mitral insufficiency. In two cases no abnormality sign has been detected. CONCLUSIONS: According to this study, it is recommended to use phonocardiography technique in order to pre-diagnose the valvular insufficiency, it's type and location and use echocardiography to determine the process of disease and control this progress.
Show more [+] Less [-]Genomic detection of Brucella spp in Seropositive cattle in charmahal va Bakhtiyari province, Iran
2015
Mahzounieh, Mohammadreza | Mehri, Hamidreza | Seidi Samani, Hassan | Momeni, Amir | Shokuhi, Ali | Khaksar, Khadijeh | Asadi, Mohammad | Safarpur, Marzieh | Yektaneh, Fatemeh | Nikpur, Payam
BACKGROUND: Brucellosis is one of the most common zoonosis in Middle East and Iran. OBJECTIVES: The purpose of this study was genomic detection of Brucella spp. in sero-positive dairy cattle. METHODS: We have collected 28,519 blood samples from cows during 2012-2013. Samples were screened by Slide and tube agglutination and 2-Mercaptoethanol tests. Samples with anti-Brucella antibodies titer ≥ 1:80 and ≥1:40 in tube agglutination and 2-ME tests were considered as positive respectively. Tissue samples include: lymph nodes, liver, testicle and kidney from 122 samples of slaughtered cows were collected. The Sero-positive samples were examined by a collection of specific primers for Brucella abortus, Brucella melitensis, vaccinal strains included RB51 and Rev1 using PCR tests. RESULTS: Results showed that 450 samples were positive in slide agglutination test and 447 samples had anti-brucella antibodies titer equal to or more than 1:80. So they were positive by tube agglutination test. Three hundred eighty nine samples were positive by 2- mercaptoethanol test. PCR test results showed that 46 samples (37.7%) out of 122 samples had a specific sequence of Brucella or otherwise they have an active infection with Brucella species, whereas 62.3% of samples were negative. The PCR results showed that 2 samples (4.35%) were infected by B. melitensis, 2 samples (4.35%) infected by Rev1 strain and 42 samples (91.3%) were infected by B. abortus. CONCLUSIONS: The results showed that, as we had expected, the majority of cows were infected by B. abortus. Animals who infected by B. melitensis and Rev1 strain may be a result of contact with sheep or goats. We couldn’t find Brucella genome in 76 samples (62.3%) of sero-positive cows. It may be caused by cross reaction of sera with Brucella species in tests or activation of immune system response and elimination of organism from internal organs.
Show more [+] Less [-]Computed tomographic anatomy and topography of the non-respiratory organs of coelomic cavity of European pond turtle (Emys orbicularis)
2015
Zehtabvar, Omid | Vajhi, Alireza | Tootian, Zahra | Rostami, Amir | Shojaei, Bahador
BACKGROUND: Reptiles, especially turtles that inhabit both on land and water, have made some special adaptations. Many people keep turtles as pets. Therefore, the anatomical knowledge of turtles should be more carefully evaluated and used for therapeutic purposes. One of these turtles is European pond turtle (Emys orbicularis). Most of vital systems are enclosed by the carapace and the plastron so it cannot be examined customarily by clinicians. The noninvasive diagnostic imaging techniques provide detailed information concerning these organs. OBJECTIVES: This study was conducted to give complete topographic information and knowledge about the position of the non respiratory organs of the coelomic cavity in the European pond turtle using Computed Tomography (CT) and usual anatomic methods. METHODS: 10 adult turtles (5 female, 5 male) were selected. All scans were obtained on a two detector scanner. In anatomical study three female and three male turtles were dissected. Two other female and male turtles were sectioned transversely. RESULTS: The results showed some differences in the position of the organs including stomach, gall bladder, liver and heart with those of other species. Moreover, the topography of the organs is described in retracted and protruded neck in this article. Retraction of the neck had an influence on the position of the organs such as oesophagus, stomach, liver and heart. CONCLUSIONS: The general morphological features of the non respiratory organs of the coelonic cavity of European pond turtle were examined by CT images and macroscopically in this study. Significant differences were found compared with other species.
Show more [+] Less [-]Anatomic assessment of tendons and ligaments of palmar surface of metacarpus in Anatoly donkey and its comparison with horse
2015
Nazem, Mohammad Naser | Sajjadian, Sayed Mohsen
BACKGROUND: SDFT, DDFT and suspensory ligament are the most important tendons and ligament of the palmar aspect of the metacarpus that contribute to stability mechanism. OBJECTIVES: The purpose of this study was to describe the tendons and ligaments of the palmar surface of metacarpus in Anatoly donkey and compare them with those in horse. METHODS: 14 healthy Anatoly donkeys without lameness were selected to detect the tendons, ligaments and their accessories on the palmar surface of metacarpus in both left and right forelimbs after euthanasia. 4 horses were also selected and their tendons and ligaments in palmar surface of metacarpus were compared with those in Anatoly donkeys. RESULTS: DDFT and suspensory ligament in this region were similar in Anatoly donkeys and horses but SDFT in Anatoly donkeys had an accessory ligament in the palmar surface of the metacarpus that was originated from the deep fascia of carp after the carpal joint and was joined to the SDFT. CONCLUSIONS: This second accessory ligament of SDFT has not been observed in the studied horses and has never been reported in the related references. The results of this study can be used in to diagnose and treat lameness in Anatoly donkeys by radiologists and surgeons.
Show more [+] Less [-]Morphometric and Molecular Analysis of Gyrodactlus kobayashi in Carassius auratus (Linnaeus, 1758)
2015
Omidzahir, Shila | Ebrahimzadeh Mousavi, Hosseinali | Shayan, Parviz | Ebrahimzadeh Abkooh, Elahe | Mahmoodzadeh, Homayoun
BACKGROUND: Fish are constantly exposed to various pathogens and parasites in particular. Gyrodactylus from Platyhelminthes is an important monogenean ectoparasite that can cause disease and economical losses to cultured, wild, salt and fresh water and ornamental fish. Gyrodactylus appears to be one of the most prevalent parasites of ornamental fish especially in Cyprinids. Objectives: The present study aimed to identify morphometric and molecular characteristics of Gyrodactylus parasite on Carassius auratus (Linnaeus, 1758). Methods: Gyrocactylus parasites were isolated from skin, fins and gills of the fish with wet mount slide and were examined under light microscopy. The morphometrical characterization of Gyrodactylus specimens was performed using the measurements and drawings of opisthaptoral hard parts of the parasites. The molecular species description was based on polymerase chain reaction (PCR) of partial sequence of 5.8S region of ribosomal RNA (5´CGATCATCGGTCTCTCGAAC3´) and partial sequence of internal transcribed spacer2 (ITS2) of ribosomal RNA (5´TTAAGGAAGAACCACTAGAG3´). ResultS: Gyrodactylus species morphology identification was performed using Yamaguti (1961) identification key. The nucleotide sequences of the PCR products were compared with GenBank sequences. Conclusions: Based on morphometric analysis and sequencing, the Gyrodactylus specimens were described as Gyrodactylus kobayashi. Combination of molecular techniques with morphological analysis seems to be the best approach to identification of Gyrodactylus spices.
Show more [+] Less [-]Ecology of snail family Lymnaeidae and effects of certain chemical components on their distribution in aquatic habitats of West Azarbaijan, Iran
2015
Imani Baran, Abbas | Yakhchali, Mohammad | MalekzadehViayeh, Reza | Sehhatnia, Baharak | Darvishzadeh, Reza
BACKGROUND: Freshwater pulmonate family Lymnaeidae are well-known for their role in transmission of diginean trematodes worldwide. Objectives: The study was aimed to investigate the ecology and effects of physical and chemical components of the environment on their distribution and populaion density. Methods: The lymnaeid snails were randomly collected from 16 freshwater habitats in West Azarbaijan Province and water samples were also provided from the habitats for chemical analysis. Results: The distribution patterns of the lymnaeid snails in all the examined sites were almost identical throughout the year except in winter. The snails were mostly found in lentic waters or slow-moving streams with muddy beds. The population densities of Lymnaea auricularia, L. gedrosiana and L. stagnalis significantly differed among the investigated waters during the course of study. The concentration of nitrate had significant positive correlations with the snails’ density while there was no significant correlation between nitrite or phosphate concentration with the population density and body size. Conclusions: The results indicated that distribution and density of the snails were affected by season and physicochemical characteristics of environments. These results can be useful for launching the control programs against parasitic trematodes in the region.
Show more [+] Less [-]Macroscopic and microscopic survey of sarcocystosis in ruminants Shahriar slaughterhouse, during 2012-2013
2015
Alibeigi, Zohreh | Rahbari, Sadegh | Hoghooghirad, Nasser | Naisi, Soheyla
BACKGROUND: Sarcocystis infection is one of the most common zoonotic protozoon diseases caused by different Sarcocystis spp. Objectives: Due to the importance of this infection in public health, the infection rate of macroscopic and microscopic cysts in sheep and cattle of abattoir of Shahriar, was investigated. Methods: 138 slaughtered sheep and cattle were selected randomly and their esophagus, diaphragm, heart, tongue, masseter and intercostal muscles were separated. In order to find cysts, the samples were examined by two methods: direct observation for macroscopic cysts and finding microscopics cysts by smear dab, Giemsa staining and microscopic investigation for bradyzoites of parasite. Results: In slaughtered samples, there was no macroscopic cyst but microscopic cysts were positive in 93.48% of cattle and 86.95% of sheep by impression smear method. The results showed the significant difference between different muscles and microscopic cysts (p<0.05) .Heart and esophagus were the most infected and tongue was the least infected part. Infections in males were more than females in both sheep and cattle. There was no significant different in various ages of cattle, however, infection in sheep less than one year old, were higher than the other ages. ConclusionS: Due to the heavy Sarcocystis infection in meat of cattle and sheep and the importance of this parasite in public health, it is suggested to avoid eating raw and undercooked meat and conduct preventive measures such as closer inspection of carcasses and local or total removal of slaughtered in abattoir.
Show more [+] Less [-]