BACKGROUND: Reptiles, especially turtles that inhabit both on land and water, have made some special adaptations. Many people keep turtles as pets. Therefore, the anatomical knowledge of turtles should be more carefully evaluated and used for therapeutic purposes. One of these turtles is European pond turtle (Emys orbicularis). Most of vital systems are enclosed by the carapace and the plastron so it cannot be examined customarily by clinicians. The noninvasive diagnostic imaging techniques provide detailed information concerning these organs. OBJECTIVES: This study was conducted to give complete topographic information and knowledge about the position of the non respiratory organs of the coelomic cavity in the European pond turtle using Computed Tomography (CT) and usual anatomic methods. METHODS: 10 adult turtles (5 female, 5 male) were selected. All scans were obtained on a two detector scanner. In anatomical study three female and three male turtles were dissected. Two other female and male turtles were sectioned transversely. RESULTS: The results showed some differences in the position of the organs including stomach, gall bladder, liver and heart with those of other species. Moreover, the topography of the organs is described in retracted and protruded neck in this article. Retraction of the neck had an influence on the position of the organs such as oesophagus, stomach, liver and heart. CONCLUSIONS: The general morphological features of the non respiratory organs of the coelonic cavity of European pond turtle were examined by CT images and macroscopically in this study. Significant differences were found compared with other species.

BACKGROUND: Fish are constantly exposed to various pathogens and parasites in particular. Gyrodactylus from Platyhelminthes is an important monogenean ectoparasite that can cause disease and economical losses to cultured, wild, salt and fresh water and ornamental fish. Gyrodactylus appears to be one of the most prevalent parasites of ornamental fish especially in Cyprinids. Objectives: The present study aimed to identify morphometric and molecular characteristics of Gyrodactylus parasite on Carassius auratus (Linnaeus, 1758). Methods: Gyrocactylus parasites were isolated from skin, fins and gills of the fish with wet mount slide and were examined under light microscopy. The morphometrical characterization of Gyrodactylus specimens was performed using the measurements and drawings of opisthaptoral hard parts of the parasites. The molecular species description was based on polymerase chain reaction (PCR) of partial sequence of 5.8S region of ribosomal RNA (5´CGATCATCGGTCTCTCGAAC3´) and partial sequence of internal transcribed spacer2 (ITS2) of ribosomal RNA (5´TTAAGGAAGAACCACTAGAG3´). ResultS: Gyrodactylus species morphology identification was performed using Yamaguti (1961) identification key. The nucleotide sequences of the PCR products were compared with GenBank sequences. Conclusions: Based on morphometric analysis and sequencing, the Gyrodactylus specimens were described as Gyrodactylus kobayashi. Combination of molecular techniques with morphological analysis seems to be the best approach to identification of Gyrodactylus spices.

Diminazene aceturate is one of a limited number of drugs currently being used in animals to treat the tsetse fly-transmitted protozoal disease, African trypanosomiasis. Efficacy of the drug at the recommended single IM administered doses of 3.5 and 7.0 mg/kg of body weight is widely acknowledged. However, resistance to the drug at these dosages has been reported. Although the mechanisms of resistance to diminazene are poorly understood, field and experimental data indicate that it may develop naturally through administration of subcurative doses, or as a result of cross-resistance. Evidence from other experimental studies indicates that there are additional mechanisms by which trypanosomes may develop resistance to diminazene aceturate. For instance, some populations ot Trypanosoma brucei and T. vivax are refractory to treatment because of their ability to invade the CNS, a site that is believed to be poorly accessible to diminazene. Furthermore, in recent studies carried out in goats, it has been documented that the ability of T. Congolense IL 3274 to survive treatment with diminazene depends on the stage of infection when treatment is administered; populations of the parasite reappeared in animals that were treated on day 19 after tsetse fly challenge, whereas all goats were cured when treated on day 1 of infection. Because trypanosomes are confined to the skin on day 1 after infection, but thereafter invade the blood circulation, it is possible that the efficacy of the treatment on day 1 is attributable to exposure of the small number of parasites, relative to later stages of infection, to higher concentrations of drug than those attained in blood. The objective of the study reported here was to determine whether diminazene's pharmacokinetics differ between plasma and lymph draining the skin of goats and therefore account for the variation in therapeutic activity of the drug at different stages of a tsetse fly-transmitted infection. Peripheral lymph was used for this work because it appears to be identical in composition to tissue interstitial fluid, into which trypanosomes are inoculated by infected tsetse flies when feeding.