Features of the primary structure of the Ph-3 gene, revealed by development of a new gene-based marker of late blight resistance in tomato | Особенности первичной структуры гена Ph-3, выявленные при создании нового маркера устойчивости томата к фитофторозу
2022
Martynov, V.V. | Kozar', E.G. | Engalycheva, I.A.
Inglés. Late blight caused by the oomycete Phytophthora infestans (Mont.) de Bary is one of the most harmful diseases of tomatoes. The most promising method to control is still the breeding of resistant varieties of tomato, in the creation of which introgression of resistance genes from wild related species is widely used. The aim of the work is to create an easy-to-use highly specific DNA marker of the Ph-3 gene, which can be used to distinguish Ph-3 from its structural homologues, and validation of this marker in comparison with already known markers based on the analysis of a collection of domestic tomato varieties and lines and evaluation of the relationship of markers with field resistance to late blight. 24 samples of tomato (Solanum lycopersicum L.) were used in the work. Primers were selected that amplify a fragment of the Ph-3 gene with a size of 412 bp: direct AATATTGAAAATAGCTGCACTGA and reverse CGAGATTTGGAGGGAATGTAA. The created marker was named Ph3-412. In addition, NC-LB-9-6678 marker primers were used for comparative analysis. To determine the nucleotide sequences of the obtained amplicons, they were cloned into a pAL-TA vector, which was transformed into competent cells Escherichia coli DH5 alpha, and sequenced by the Sanger method. When comparing the results of molecular analysis with the data of the phenotypic assessment of field resistance to late blight, none of the markers showed an unambiguous relationship with field resistance. It has been confirmed that the fragment amplified with Ph3-412 primers belongs to the Ph-3 gene, while the fragment of 601 bp in size, which is obtained with NC-LB-9-6678 primers, corresponds to the SlRGA4 homologue. It is shown that a fragment of 907 bp in size obtained with the same primers is homologous to the Ph-3 gene, but at the same time contains an insert of the LTR retrotransposon of the Ty1-copia family with a size of 306 bp. In all varieties in which the Ph-3 gene was detected, it contained the above insertion. Genotypes in which the Ph-3 gene does not have a retrotransposon insertion are of great breeding value.
Mostrar más [+] Menos [-]Ruso. Фитофтороз, вызываемый оомицетом Phytophthora infestans (Mont.) de Bary, - одно из самых вредоносных заболеваний томатов. Наиболее перспективным методом борьбы с ним остается выведение устойчивых сортов, при создании которых широко используется интрогрессия генов устойчивости из дикорастущих родственных видов. Цель работы - создание простого в использовании высокоспецифичного ДНК-маркера гена Ph-3, с помощью которого можно отличить Ph-3 от его структурных гомологов, и валидация этого маркера в сравнении с уже известными маркерами на основе анализа коллекции отечественных сортов и линий томата и оценки связи маркеров с полевой устойчивостью к фитофторозу. В работе использовали 24 образца томата (Solanum lycopersicum L.). Были подобраны праймеры, амплифицирующие фрагмент гена Ph-3 размером 412 п.н.: прямой AATATTGAAAATAGCTGCACTGA и обратный CGAGATTTGGAGGGAATGTAA. Созданный маркер получил название Ph3-412. Кроме того, для сравнительного анализа использовали праймеры маркера NC-LB-9-6678. Для определения нуклеотидных последовательностей полученных ампликонов их клонировали в вектор pAL-TA, которым трансформировали компетентные клетки Escherichia coli DH5альфа, и секвенировали по методу Сэнгера. При сравнении результатов молекулярного анализа с данными фенотипической оценки полевой устойчивости к фитофторозу ни один из маркеров не показал однозначной связи с полевой устойчивостью. Подтвердили, что амплифицируемый с помощью праймеров Ph3-412 фрагмент принадлежит гену Ph-3, в то время как фрагмент размером 601 п.н., который получают с праймерами NC-LB-9-6678, соответствует гомологу SlRGA4. Показано, что фрагмент размером 907 п.н., полученный с теми же праймерами, гомологичен гену Ph-3, но при этом содержит вставку LTR ретротранспозона семейства Ty1-copia размером 306 п.н. У всех сортов, у которых был обнаружен ген Ph-3, он содержал вышеуказанную вставку. Набольшую селекционную ценность представляют генотипы, у которых ген Ph-3 не имеет вставки ретротранспозона.
Mostrar más [+] Menos [-]Palabras clave de AGROVOC
Información bibliográfica
Este registro bibliográfico ha sido proporcionado por Central Scientific Agricultural Library