First Report of Dahlia Latent Viroid Infecting Dahlia in China

Dahlia pinnata Cav. (Asteraceae), a bushy, herbaceous ornamental plant widely cultivated in China, is frequently infected by viruses and viroids including tobacco mosaic virus, potato virus Y, cucumber mosaic virus (CMV), tobacco streak virus, dahlia mosaic virus, dahlia common mosaic virus, potato spindle tuber viroid (PSTVd), and dahlia latent viroid (DLVd) (Pappu et al. 2008). DLVd (Hostuviroid, Pospiviroidae) was first characterized in Netherlands as a novel species in 2010 from dahlia without discernible symptoms (Verhoeven et al. 2013) and later in Japan and the United Kingdom (Monger 2018; Tsushima et al. 2015). These findings drew attention toward the study of DLVd infection in dahlia and its potential risk in domestic dahlia cultivation. During June 2013 to September 2018, dahlia plants showing dwarfism were observed in some gardens including Beijing Botanical Garden, Beijing Zhongshan Park, and Xiangshan Park in Beijing, China. To determine the potential pathogen(s), a symptomatic leaf sample was collected, and total RNA was extracted with TRIzol reagent (Invitrogen, Carlsbad, CA) with a standard procedure following the instructions, and it was subsequently used for small RNA deep sequencing library construction. The high-throughput sequencing was conducted on an Illumina HiSeq 4000 platform, and the reads generated were de novo assembled into contigs with CLC Genomics Workbench software, and candidate virus(es)/viroid(s) were screened through BLASTN and BLASTX analysis. Results showed 15 contigs shared high nucleotide sequence identity with CMV and two with DLVd, which covered the whole genome of DLVd. To further confirm the presence of DLVd, a primer pair (DLVd F, CAGGTCTTCTAAGGGTTCCTGTGGT; and DLVd R, GGGCTTCTTTGGAGCCCTGGGCGC) was designed and reverse transcription PCR (RT-PCR) conducted. The amplicon was ligated to pMD19-T vector (TaKaRa, Dalian, China) and sequenced. Sequence analysis showed it (accession no. KT119407) shared 100% nucleotide sequence identity with the reported sequences (GenBank accession nos. JX263426.1, LC036322.1 and MG214159.1). Furthermore, a total of 15 asymptomatic dahlia leaf samples were collected and verified by RT-PCR using the abovementioned DLVd primers. Of these samples, five were DLVd positive, in accordance with the previous report that DLVd existed in asymptomatic samples. This was the first report of DLVd infecting dahlia in China. Although DLVd was asymptomatic in dahlia, when in mixed infection with PSTVd negative synergistic interaction was observed (Tsushima et al. 2015). In this study, DLVd was coinfected with CMV, and their interaction needed to be investigated. Furthermore, a larger scale survey of symptomatic and asymptomatic dahlia plants is needed to determine the distribution and prevalence of DLVd in China and its potential risk in dahlia cultivation, especially when coinfected with other viruses/viroids.