First Report of Cotton Leafroll Dwarf Virus in Upland Cotton (Gossypium hirsutum) in Mississippi

Cotton leafroll dwarf virus (CLRDV), associated with “cotton blue disease” known to occur in Africa, Asia-Pacific, and South America (Corrêa et al. 2005; Distéfano et al. 2010; Ray et al. 2016), has been recently reported from Alabama (Avelar et al. 2019), which prompted a survey of the Mississippi (MS) cotton production area during late October and early November 2018. During the survey, 60 samples of healthy-looking and CLRDV-suspect plants were collected from 17 counties and tested for the presence of the virus. Diseased plants expressed a range of symptoms including leaf curling, reddening and distortion, unusual secondary plant growth characterized by shortened internodes, and a general reduction in boll set. Cotton aphids (Aphis gossypii Glover) were also present on some of the collected plant material. Disease incidence in individual fields, estimated visually, ranged from <1% to >20% with the greater values occurring in southeast MS. Thirteen samples were initially tested at the Plant Disease Diagnostic Lab at Auburn University with a two-step RT-PCR protocol (Sharman et al. 2015), while the remainder were examined in the Plant Virology Lab at Mississippi State University with two independent single-tube RT-PCR tests originally designed in this study. To prepare samples for virus-specific tests, total RNAs were purified from petioles using the manufacturer’s protocol for the Qiagen Plant RNA Easy kit. A single-tube RT-PCR test was performed using a set of primers (CLRDV-CPF1 5′ ACGACGAAGACGAGGAGGTC′ and CLRDV-CPR1 5′ GAACCGGAGGATGTTGAAGAGG 3′) designed to amplify a 249-nt-long segment of the viral coat protein (CP) gene. A specific PCR product of predicted size was present in 38 samples collected from 13 counties indicating relatively high virus incidence (63%) and prevalence (76%). No visible bands were present in negative and water/blank controls. No discrepancies in results were observed when 10 randomly selected samples tested in one-tube tests with CP primers were verified by the protocol of Sharman et al. (2015) and with another set of primers designed in this study targeting a 770-nt-long portion of viral RdRp gene (CLRDV-RdRpF2 5′GGAGCCGCACAAACAAGCTAA 3′and CLRDV-RdRpR1 5′ AACAGGCGTTCAGGTAGTTGGA 3′). Both amplicons (249 bp and 770 bp) from six samples collected from four counties (Bolivar, Grenada, Tallahatchie, and Washington) were cloned and custom sequenced. Pair-wise and BLASTn analyses revealed that they share highly conserved nucleotide content (95 to 100%) with each other and with the recent record from Alabama (GenBank MH883236), as well as with CLRDV isolates from Brazil and Argentina available in the NCBI/GenBank (December 2018). Nucleotide sequences of two genomic regions (RdRp and CP) for six virus isolates from Mississippi have been deposited in GenBank under accession nos. MK512759 to MK512770. This is the first report of polerovirus infections of cotton in MS. Results from this study, along with recent report of the same virus from Alabama, call for multidisciplinary research to understand population structure, epidemiology and ecology of the virus, and its potential impact on the United States cotton industry.