RAPID DNA EXTRACTION AND PCR VALIDATION FOR DIRECT DETECTION OF Listeria monocytogenes IN RAW MILK

anglais. Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk. Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, to reduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, to avoid the polymerization. The raw milk samples were analyzed by using the traditional gold standard method for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize the Listeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer sets were use: L1 (CTCCATAAAGGTGACCCT), U1 (CAGCMGCCGCGGTAATWC), LF (CAAACGTTAACAACGCAGTA) and LR (TCCAGAGTGATCGATGTTAA) that recognize the hlyA gene of L. monocytogenes, amplifying a 750bp fragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strains of L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species, respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of 0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of 100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. by using any of the three methods since they share the same sensitivity and specificity. One hundred percent of the predictive value for PCR (alternative method) provides high reliability, and allows the detection of the positive samples. The extraction procedure combined with a PCR method can reduce in 15 days the time of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validated to be use for other types of food such as poultry, meat products and cheeses.

espagnol; castillan. Objetivo. Validar un método para la detección directa de L. monocytogenes en leche cruda. Materiales y métodos. Se utilizó un procedimiento de extracción con el agente caotropico NaI, para reducir la grasa en la muestra a un 0.2% p/v, el cual es mas bajo limite de detección con el método de Gerber para evitar la polimerización. Las muestras de leche cruda fueron analizadas por el método estandar de oro para la detección de L. monocytogenes. La detección por PCR fue realizada amplificando el segmento específico de 938bp de 16S ADNr. Los siguientes cebadores fueron utilizados L1 (CTCCATAAAGGTGACCCT), U1 (CAGCMGCCGCGGTAATWC), LF (CAAACGTTAACAACGCAGTA) and LR (TCCAGAGTGATCGATGTTAA) que reconoce el gen hlyA de L. monocytogenes y que amplifica un fragmento de 750bp. Resultados. El ADN de 39 cepas evidenció una alta especificidad de la técnica ya que todas las 39 L. monocytogenes amplificaron los fragmentos de 938bp y 750bp especie especifica. El límite de detección de la PCR fue de 101 CFU/ml. La reproducibilidad de la PCR mostró un Kappa de 0.85, la especificidad y sensibilidad fueron del 100%. El valor predictivo positivo y negativo fue del 100%. Conclusiones. Los resultados demostraron que es posible detectar Listeria spp usando cualquiera de los tres métodos ya que poseen la misma sensibilidad y especificidad. El 100% del valor predictivo positivo provee una alta posibilidad de detección en muestras positivas con listeria. EL método de extracción y la PCR estandarizada permiten en 15 días detectar L. monocytogenes en leches crudas. La técnica de PCR puede ser adaptada y validada otros tipos de alimentos como pollos, carnes y quesos.