Species specific mitochondrial Cytochrome c oxidase gene sequence of Manipuri pony
2014
KSH. MIRANDA DEVI | MONIKA AHANTHEM | SANKAR KUMAR GHOSH
The Manipuri pony, a unique indigenous horse breed of India, is known for its fastness, intelligence, surefooted moves and high endurance. The use of DNA barcodes, short DNA sequences from a standardized region of the mitochondrial (mt) genome, has recently been proposed as a tool to facilitate species identification. However, for this emblematic species, there is lacking in the development of DNA barcode which will remain as the molecular tag in the future. A specific molecular identification tag of Manipuri pony was developed under the Accession no. JN228963, and analysis within this family found that the individuals of a single species grouped closely together. Using a set of primer (forward-5´CCAACCACAAAGACATTGGCAC 3´ and reverse- 5´ CTTCTGGGTGGCAA AGAATCA 3´), PCR amplification based on the total genomic DNA extracted from hair samples of Manipuri pony gave an amplification product of 669bp which lies within the barcode region of COI gene of the mitochondrial genome. The partial sequence of COI gene, which is the DNA barcode of Manipuri pony will remain as the molecular identification mark for this species in the future. Additionally, it will also enhance the conservation of genetic resources of Manipuri pony. COI sequence divergence for conspecific individuals of Equidae family was 0.46%, whereas those for congeneric species averaged 6.75% (3.3% to 9.5%). The present finding reaffirmed a very close genetic similarity among the Equidae species. The results showed that analysis based on mt COI gene can be useful for explaining the phylogenetic relationships in the family Equidae.
Afficher plus [+] Moins [-]Mots clés AGROVOC
Informations bibliographiques
Cette notice bibliographique a été fournie par Directory of Open Access Journals
Découvrez la collection de ce fournisseur de données dans AGRIS