Identification and molecular characterization of citrus variegation virus in Lebanon
2015
Abou Kubaa, R. | Choueiri, E. | El Khoury, M. I. | Djelouah, K.
Citrus is one of the main fruit crops of Lebanon, covering a surface area of ca. 10,000 ha and accounting for 8% of the total area given over to woody crops. The major citrus production regions are in the South and North of the country and along the coastal area. Citrus variegation virus (CVV), the causal agent of infectious variegation disease, is a member of the genus Ilarvirus (subgroup 2) in the family Bromoviridae. During a survey of four commercial citrus groves at Abde-LARI station (North Lebanon) and in Saida and Ghazieyyeh regions (South Lebanon), 28 leaf samples of sweet orange and lemon trees, some of which with puckered leaves and/or fruit deformation, were collected and tested by RT-PCR for CVV using specific primers cvv249fw (5’ TACCATTGCCTACATGACCC 3’) and cvv249rev (5’ GCCTTCATTCGGAAACCGTG 3’) (Loconsole et al., 2009), and total nucleic acids were extracted with the silica capture protocol (Foissac et al., 2001). RT-PCR results were consistent with the presence of CVV in one common lemon tree showing leaf and fruit deformations. The DNA product was cloned in pUC18 (Life Technologies, USA) and sequenced. The partial coat protein sequence (249 bp) was deposited in GenBank under the accession No. LN829412. Sequence analysis revealed 97% nucleotide identity with the Italian CVV isolate UBAcvv999 (FJ228143). To our knowledge, this is the first record of CVV from Lebanon.
Показать больше [+] Меньше [-]Ключевые слова АГРОВОК
Библиографическая информация
Эту запись предоставил National Agricultural Library