First Report of Chilli veinal mottle virus Infecting Solanum aethiopicum in China
2018
Li, Y. Y. | Ma, Y. | Meng, Y. | Huang, M. Z. | Ren, G. M. | Zhao, J. F. | Li, F.
Solanum aethiopicum, commonly known as Ethiopian eggplant, scarlet eggplant, or bitter eggplant, is a species of genus Solanum, which is cultivated as a kind of vegetable in most African countries and some regions of Yunnan Province of southwest China. In July 2016, mottle, mosaic, and blistering symptoms were observed on leaves of S. aethiopicum plants in two fields in Mangshi city of Yunnan, China. The symptomatic plant incidence ranged from 3 to 10% in different fields. Total nucleic acids were extracted from six symptomatic leaf samples using a CTAB method and used as templates for virus detection by RT-PCR with reverse transcription M-MLV (RNase H–) (TaKaRa Biotech, Dalian, China). The universal primers TobamoF/TobamoR for the genus Tobamovirus (Li et al. 2014), CIFor/CIRev for the genus Potyvirus (Ha et al. 2008), PoconF/PococpR for the genus Polerovirus (Zhou et al. 2011), BegoAFor1/BegoARev1 for the genus Begmovirus (Ha et al. 2006), and specific primers CMVCPuF (TCTCATGGATGCTTCTCCGCG)/CMVCPuR (CCGTAAGCTGGATGGACAACC) for Cucumber mosaic virus (CMV) and TSWVF (TCACTGTAATGTTCCATAGCAA)/TSWVR (AGAGCAATYGTGTCAATTTTATTC) for Tomato spotted wilt virus (TSWV) were used in RT-PCR. A fragment of approximately 700 bp was obtained from five of the six samples with the primer pair of CIFor/CIReV. One of the amplicons was cloned using pMD19-T vector (TaKaRa Biotech) and sequenced (GenBank accession no. MF614118). NCBI BLAST search revealed it shared the highest nucleotide sequence identity of 96% with Chilli veinal mottle virus (ChiVMV) isolates Pp4 from Capsicum chinense (KC711056) and Yp8 from C. annuum (KC711055). To confirm the presence of ChiVMV in S. aethiopicum samples, the six original samples were tested by RT-PCR using the ChiVMV-specific primer pair (nt 8269 to 9189 of ChiVMV genome [AJ247843]) ChiVMVF (GGATAGAGCTGARCARCCAG) and ChiVMVR (CTTTGAAGCCCATATCTTGGC) for the amplification of coat protein gene of ChiVMV. Amplicons of the expected size (920 bp) were obtained from the five previously identified positive samples. One amplicon was purified with the Universal DNA Purification Kit (TIANGEN Biotech Co., Ltd., Beijing, China) and directly sequenced (GenBank accession no. MF614117). NCBI BLAST search showed it shared the highest nucleotide sequence identity of 98% with ChiVMV isolate Yp8 (KC711055) and 97% with Pp4 (KC711056). Sap of the ChiVMV-positive S. aethiopicum leaves were mechanically inoculated onto healthy S. aethiopicum plants by injection. Mosaic and blistering symptoms were observed in inoculated S. aethiopicum systemic leaves, which were further tested by RT-PCR with the ChiVMV-specific primers ChiVMVF/ChiVMVR. Subsequent sequencing results showed the inoculated S. aethiopicum plants were infected with ChiVMV. Taken together, all the results revealed the S. aethiopicum symptomatic samples from Mangshi city were infected by ChiVMV. Nonetheless, ChiVMV was not detected in S. aethiopicum virus-like samples collected from Longlin County and Jinghong city of Yunnan Province. ChiVMV infection of S. aethiopicum has only been previously reported in Italy and Tanzania to date (Nono-Womdim et al. 2001). To our knowledge, this is the first report of ChiVMV naturally infecting S. aethiopicum in China. ChiVMV was also detected from tomato and pepper plants in Yunnan. Therefore, effective management strategies should be taken to prevent this virus in vegetables growing regions.
Показать больше [+] Меньше [-]Ключевые слова АГРОВОК
Библиографическая информация
Эту запись предоставил National Agricultural Library