First report of maize-associated umbra-like virus in maize in Brazil.

To investigate the virome in maize plants, sixteen maize leaf samples with viral symptoms of yellow stripes from three Brazilian locations (Riacho Fundo/DF, Juazeiro/BA, and Uberlândia/MG) were pooled, and viral particles were semi- purified via differential centrifugation and a 20% sucrose cushion step. Semi-purified virus from gramineous plants showing yellow stripes (eight plants of Brachiaria spp. and twelve plants of Panicum spp. from Campo Grande, MS, Brazil) was also prepared using the same method aiming to investigate viruses associated with maize plants. Total RNA from two pooled samples was extracted using the Quick- RNA Plant Miniprep Kit (Zymo Research) and sequenced together by high-throughput sequencing (HTS) on the Illu- mina NovaSeq6000 platform, generating 10 G reads of 150 nt paired-ends for metagenomic analysis. The sequences were analyzed using bioinformatics methods as described by Blawid et al. (2017). A 3,006-nt contig, which had the higher identity with maize-associated umbra-like virus (MaULV) was assembled from 3,695 reads, with a cover- age of 182.4x. The genomic sequence of the MaULV isolate (LC851045) showed 97.41% identity with the Mexican iso- late (OK018180) and 95.52% with the Ecuadorian isolate (OM937759). The same maize leaf samples showing yel- low stripes used for the metagenomic study (16 samples) had been individually stored in an ultrafreezer and tested for MaULV by RT-PCR using the primers, Maize_Umbra_F (CGAAAATACAAGATCCAACCGA) and Maize_Umbra_R (ATCCGTCTGCCTTCAACCTC) targeting the open read- ing frame 2 of MaULV (593nt long). Total RNA form leaf samples was extracted using the Total RNA Purification kit (Cellco Biotec). cDNA was synthesized with M-MLV RT (Thermo Fisher Scientific) and amplified for PCR (Taq DNA Polymerase, Sinapse Biotecnologia). Two maize sam- ples from Juazeiro (BA) out of 16 were positive by RT-PCR, which were also confirmed by RT-qPCR using the GoTaq® qPCR Master Mix kit (Promega), with the primers Maize_ Umbra_qPCR_F (A G CGTGGAGCAATTGAGTC) and Maize_Umbra_qPCR_R (CATCGACCGACTTCAGCCAA). MaULV was not detected in other gramineous plants used for the metagenomic study. The two MaULV-positive samples were also positive for maize rayado fino virus and maize striate mosaic virus by RT-PCR, showing co-infec- tions. This is the first report of MaULV in Brazil.

On line.