First Report of Northern Root-Knot Nematode Meloidogyne hapla on Bupleurum chinense in Gansu Province, China

Bupleurum chinense is an important traditional medicine in China with anti-inflammatory and immunomodulatory effects (Navarro et al. 2001). Diseases of B. chinense have been caused by fungi (rust and root rot) and viruses (cucumber mosaic virus and broad bean wilt virus 2) (Zhang et al. 2009) but not by nematodes. Root-knot nematodes (RKNs, Meloidogyne spp.) are destructive plant-parasitic nematodes with high adaptability and diversity, infecting >5,500 species (Azevedo de Oliveira et al. 2018). In October 2020, symptoms of dwarfing, leaf yellowing, and roots with many knots on B. chinense were seen in fields in Dingxi, Gansu, northwest China (N 35°19′42″; E 104°2′24″). Hundreds of eggs, mature males, and females were exuded from dissection of washed root knots. Morphology was examined with an optical microscope. Female (n = 15) perineal patterns were oval with slightly dorsal arches, and lateral lines and punctations on the anus in some specimens. Measurements (mean ± SD [range]) of females (n = 20): body length (L) = 525.23 ± 59.88 μm (439.72 to 659.93 μm), maximum body width (W) = 403.92 ± 57.17 μm (311.01 to 513.34 μm), stylet length (St) = 11.28 ± 1.05 μm (9.82 to 12.91 μm), median bulb width (MBW) = 31.13 ± 3.32 μm (23.66 to 35.55 μm), distance from anterior end to center of median esophageal bulb valve (MB) = 64.45 ± 3.44 μm (58.62 to 71.92 μm), and dorsal gland orifice to stylet (DGO) = 3.79 ± 0.60 μm (2.72 to 5.00 μm). Males (n = 20): L = 1,038.25 ± 90.34 μm (877.28 to 1,206.12 μm), St = 18.13 ± 1.48 μm (15.10 to 20.12 μm), body length divided by greatest body width (a) = 31.77 ± 4.03 (23.29 to 41.16), MBW = 10.97 ± 0.78 μm (9.05 to 12.31 μm), MB = 64.81 ± 3.45 μm (59.59 to 71.38 μm), DGO = 4.05 ± 0.47 μm (3.11 to 5.08 μm), and spicule length (Spic) = 22.57 ± 1.91 μm (19.26 to 26.43 μm). J2s (n = 25): L= 381.73 ± 25.85 μm (336.96 to 419.98 μm), St = 10.52 ± 1.03 μm (9.15 to 12.14 μm), a = 24.35 ± 2.10 (20.45 to 28.29), DGO = 3.02 ± 0.42 μm (2.42 to 3.79 μm), body length divided by tail length (c) = 8.90 ± 0.86 (7.71 to 10.48), and tail length divided by body width at anus (c′) = 4.18 ± 0.50 (3.47 to 5.04). According to morphological characteristics, it was preliminarily identified as Meloidogyne hapla Chitwood, 1949 (Whitehead 1968). DNA was extracted from 10 females, and the ITS region and the D2-D3 region of 28S rDNA were amplified using primers TW81/AB28 (GTTTCCGTAGGTGAACCTGC/ATATGCTTAAGTTCAGCGGGT) (Subbotin et al. 2000) and D2A/D3B (ACAAGTACCGTGAGGGAAAGTTG/TCGGAAGGAACCAGCTACTA) (De Ley et al. 1999), respectively. PCR products were purified and sequenced. The ITS and D2-D3 regions were 557 and 762 bp, respectively. The ITS region sequence (GenBank OK030559) was 99.46 to 99.82% identical to M. hapla from China (MT490918), New Zealand (JX465560), Australia (AF516722), and Japan (LC030357). The D2-D3 sequence (OK030558) was 99.58 to 100.00% identical to M. hapla from Canada (MW182329), Ethiopia (KJ645432), the United States (KP901086), and China (MN446015). Fragments obtained using the specific primers of M. hapla (Mh-F/Mh-R) were 462 bp, which was consistent with M. hapla (Feng et al. 2008). Thus, the RKNs on B. chinense in China were identified as M. hapla. Six B. chinense seedlings were planted in sterilized soil in 16-cm-diameter, 20-cm-deep plastic pots in the greenhouse at 20 to 25°C. After 21 days, 2,000 J2s/pot were inoculated; six uninoculated seedlings were a control. After 90 days, all inoculated plants showed similar symptoms to those in the field, and the reproduction factor (final population density/initial population density) was 1.47. No symptoms were seen on controls. These results proved that the nematode infecting B. chinense is M. hapla. This is the first report of B. chinense as a host of M. hapla in China. B. chinense is cultivated on ∼19.1 million ha in Gansu, yielding 40% of China’s output (Wang et al. 2017). The short, stunted roots of B. chinense-infected M. hapla harm its medical quality and restrict development of the local Chinese herbal medicine industry.