BACKGROUND: Brucellosis is one of the most common zoonosis in Middle East and Iran. OBJECTIVES: The purpose of this study was genomic detection of Brucella spp. in sero-positive dairy cattle. METHODS: We have collected 28,519 blood samples from cows during 2012-2013. Samples were screened by Slide and tube agglutination and 2-Mercaptoethanol tests. Samples with anti-Brucella antibodies titer ≥ 1:80 and ≥1:40 in tube agglutination and 2-ME tests were considered as positive respectively. Tissue samples include: lymph nodes, liver, testicle and kidney from 122 samples of slaughtered cows were collected. The Sero-positive samples were examined by a collection of specific primers for Brucella abortus, Brucella melitensis, vaccinal strains included RB51 and Rev1 using PCR tests. RESULTS: Results showed that 450 samples were positive in slide agglutination test and 447 samples had anti-brucella antibodies titer equal to or more than 1:80. So they were positive by tube agglutination test. Three hundred eighty nine samples were positive by 2- mercaptoethanol test. PCR test results showed that 46 samples (37.7%) out of 122 samples had a specific sequence of Brucella or otherwise they have an active infection with Brucella species, whereas 62.3% of samples were negative. The PCR results showed that 2 samples (4.35%) were infected by B. melitensis, 2 samples (4.35%) infected by Rev1 strain and 42 samples (91.3%) were infected by B. abortus. CONCLUSIONS: The results showed that, as we had expected, the majority of cows were infected by B. abortus. Animals who infected by B. melitensis and Rev1 strain may be a result of contact with sheep or goats. We couldn’t find Brucella genome in 76 samples (62.3%) of sero-positive cows. It may be caused by cross reaction of sera with Brucella species in tests or activation of immune system response and elimination of organism from internal organs.

BACKGROUND: Reptiles, especially turtles that inhabit both on land and water, have made some special adaptations. Many people keep turtles as pets. Therefore, the anatomical knowledge of turtles should be more carefully evaluated and used for therapeutic purposes. One of these turtles is European pond turtle (Emys orbicularis). Most of vital systems are enclosed by the carapace and the plastron so it cannot be examined customarily by clinicians. The noninvasive diagnostic imaging techniques provide detailed information concerning these organs. OBJECTIVES: This study was conducted to give complete topographic information and knowledge about the position of the non respiratory organs of the coelomic cavity in the European pond turtle using Computed Tomography (CT) and usual anatomic methods. METHODS: 10 adult turtles (5 female, 5 male) were selected. All scans were obtained on a two detector scanner. In anatomical study three female and three male turtles were dissected. Two other female and male turtles were sectioned transversely. RESULTS: The results showed some differences in the position of the organs including stomach, gall bladder, liver and heart with those of other species. Moreover, the topography of the organs is described in retracted and protruded neck in this article. Retraction of the neck had an influence on the position of the organs such as oesophagus, stomach, liver and heart. CONCLUSIONS: The general morphological features of the non respiratory organs of the coelonic cavity of European pond turtle were examined by CT images and macroscopically in this study. Significant differences were found compared with other species.

BACKGROUND: SDFT, DDFT and suspensory ligament are the most important tendons and ligament of the palmar aspect of the metacarpus that contribute to stability mechanism. OBJECTIVES: The purpose of this study was to describe the tendons and ligaments of the palmar surface of metacarpus in Anatoly donkey and compare them with those in horse. METHODS: 14 healthy Anatoly donkeys without lameness were selected to detect the tendons, ligaments and their accessories on the palmar surface of metacarpus in both left and right forelimbs after euthanasia. 4 horses were also selected and their tendons and ligaments in palmar surface of metacarpus were compared with those in Anatoly donkeys.  RESULTS: DDFT and suspensory ligament in this region were similar in Anatoly donkeys and horses but SDFT in Anatoly donkeys had an accessory ligament in the palmar surface of the metacarpus that was originated from the deep fascia of carp after the carpal joint and was joined to the SDFT. CONCLUSIONS: This second accessory ligament of SDFT has not been observed in the studied horses and has never been reported in the related references. The results of this study can be used in to diagnose and treat lameness in Anatoly donkeys by radiologists and surgeons.

BACKGROUND: Fish are constantly exposed to various pathogens and parasites in particular. Gyrodactylus from Platyhelminthes is an important monogenean ectoparasite that can cause disease and economical losses to cultured, wild, salt and fresh water and ornamental fish. Gyrodactylus appears to be one of the most prevalent parasites of ornamental fish especially in Cyprinids. Objectives: The present study aimed to identify morphometric and molecular characteristics of Gyrodactylus parasite on Carassius auratus (Linnaeus, 1758). Methods: Gyrocactylus parasites were isolated from skin, fins and gills of the fish with wet mount slide and were examined under light microscopy. The morphometrical characterization of Gyrodactylus specimens was performed using the measurements and drawings of opisthaptoral hard parts of the parasites. The molecular species description was based on polymerase chain reaction (PCR) of partial sequence of 5.8S region of ribosomal RNA (5´CGATCATCGGTCTCTCGAAC3´) and partial sequence of internal transcribed spacer2 (ITS2) of ribosomal RNA (5´TTAAGGAAGAACCACTAGAG3´). ResultS: Gyrodactylus species morphology identification was performed using Yamaguti (1961) identification key. The nucleotide sequences of the PCR products were compared with GenBank sequences. Conclusions: Based on morphometric analysis and sequencing, the Gyrodactylus specimens were described as Gyrodactylus kobayashi. Combination of molecular techniques with morphological analysis seems to be the best approach to identification of Gyrodactylus spices.

BACKGROUND: Freshwater pulmonate family Lymnaeidae are well-known for their role in transmission of diginean trematodes worldwide. Objectives: The study was aimed to investigate the ecology and effects of physical and chemical components of the environment on their distribution and populaion density. Methods: The lymnaeid snails were randomly collected from 16 freshwater habitats in West Azarbaijan Province and water samples were also provided from the habitats for chemical analysis. Results: The distribution patterns of the lymnaeid snails in all the examined sites were almost identical throughout the year except in winter. The snails were mostly found in lentic waters or slow-moving streams with muddy beds. The population densities of Lymnaea auricularia, L. gedrosiana and L. stagnalis significantly differed among the investigated waters during the course of study. The concentration of nitrate had significant positive correlations with the snails’ density while there was no significant correlation between nitrite or phosphate concentration with the population density and body size. Conclusions: The results indicated that distribution and density of the snails were affected by season and physicochemical characteristics of environments. These results can be useful for launching the control programs against parasitic trematodes in the region.

BACKGROUND: Sarcocystis infection is one of the most common zoonotic protozoon diseases caused by different Sarcocystis spp. Objectives: Due to the importance of this infection in public health, the infection rate of macroscopic and microscopic cysts in sheep and cattle of abattoir of Shahriar, was investigated. Methods: 138 slaughtered sheep and cattle were selected randomly and their esophagus, diaphragm, heart, tongue, masseter and intercostal muscles were separated. In order to find cysts, the samples were examined by two methods: direct observation for macroscopic cysts and finding microscopics cysts by smear dab, Giemsa staining and microscopic investigation for bradyzoites of parasite. Results: In slaughtered samples, there was no macroscopic cyst but microscopic cysts were positive in 93.48% of cattle and 86.95% of sheep by impression smear method. The results showed the significant difference between different muscles and microscopic cysts (p<0.05) .Heart and esophagus were the most infected and tongue was the least infected part. Infections in males were more than females in both sheep and cattle. There was no significant different in various ages of cattle, however, infection in sheep less than one year old, were higher than the other ages. ConclusionS: Due to the heavy Sarcocystis infection in meat of cattle and sheep and the importance of this parasite in public health, it is suggested to avoid eating raw and undercooked meat and conduct preventive measures such as closer inspection of carcasses and local or total removal of slaughtered in abattoir.

BACKGROUND: Enhancement of the immune system seems to be the most promising method of preventing fish diseases and increasing growth rate. Objectives: The purpose of the present study was to investigate the influence of dietary administration of Zataria multiflora Boiss and Menthapulegium L extracts on phagocytosis, lysozyme, respiratory burst and total white and red blood cells (WBC/RBC) of rainbow trout (Oncorhynchus mykiss). Methods: Two hundred and ten fish (100±10 g) were used in a completely randomized design with 7 treatment and 3 replicates in a 2 weeks period (from 0 to 14 d). The basal diet supplemented with 0 (control), 20, 50 and 100 mg/kg food Z. multiflora and M.pulegium extracts. At the end of the experiment (after 14 days), samples from kidney and blood of the fish were collected in order to determine WBC/RBC (by neubauer chamber), serum lysozyme activity (by turbid metric assay, phagocytosic (by number of yeast cells phagocytosed method) and respiratory burst activities (by reduction of nitroblue tetrazolium method) of head kidney tissue. Results: The results indicated that the highest ratio of phagocytosis and respiratory burst activity was observed in 50 mg/kg extract concentration of Z. multiflora (p<0.05). The highest WBC lysozyme activities were seen   in 100 mg/ kg extract concentration of Z. multiflora. No significant difference was shown between RBC in treatment groups and control group (p>0.05). The highest ratio of phagocytosis activity was observed in 100 mg/kg extract concentration of M. pulegium (p<0.05). No significant difference was observed between WBC /RBC, lysozyme, respiratory burst means in treatment groups and control group (p>0.05). Conclusions: It can be concluded that 50 and 100 mg/ kg of the methanol Z. multiflora and 100 mg/ kg M. pulegium have positive effects on stimulating of innate immune system in O.mykiss, but the influence of Z. multiflora extract with100 mg/ kg  concentration is  better than  M. pulegium extract.

BACKGROUND: The repetitive use of antibiotics in different fields (veterinary and medicine) improves the emergence and occurrence of the resistance phenomenon in pathogenic bacteria. Due to the problem of antimicrobial resistance, it is an urgent need to discover new drugs and alternative treatments for the control of bacterial diseases in aquaculture. OBJECTIVES: The purpose of this study is to investigate antibacterial effects of methanol and hexane extracts of medicinal plants Rattles (Prosopis farcta), datura (Datura stramunium L) and milkweed (Calotropis procera L), the major pathogenic bacteria of fish, including Aeromonas hydrophila, Yersinia ruckeri and Streptococcus iniae. METHODS: Extraction was performed using a rotary evaporator. To determine the minimum inhibitory concentration (MIC), the standard microdilution method (Dilution in broth) was used and the minimum bactericidal concentration (MBC) was determined based on MIC values obtained for each extract. RESULTS: The results showed that the effect of most potent extract, methanol extract obtained from fruit rattle on the three studied bacteria, with MIC and MBC are 25, 50mg/ml, respectively. The most sensitive bacteria to methanol and hexane plant extracts, is bacterium Streptococcus iniae and Aeromonas hydrophila and Yersiniaruckeri bacteria were resistant. The studied extracts had stronger antibacterial properties against gram-positive bacteria compared to gram-negative. CONCLUSIONS: According to the results, it seems that the use of methanol extract of Prosopis farcta fruit is effective for treatment of bacterial diseases in aquaculture.

BACKGROUND: Corynebacterium pseudotuberculosis is the etiological agent of caseous lymphadenitis (CLA), a chronic and very common disease in sheep and goats, which can lead to severe economic losses in the livestock industry.OBJECTIVES: This study aims to investigate the prevalence of CLA in sheep in Kurdistan province of Iran using phenotypic and molecular methods, and assess the antibiotic resistance of isolated Corynebacterium pseudotuberculosis.METHODS: In this study, from September to March 2022, 270 samples of skin abscesses were collected from sheep in livestock farms of Kurdistan province. Immediately, using the cold chain system, the samples were transferred to the microbiology laboratory of the Faculty of Medicine at Kurdistan University of Medical Sciences. Identification of isolates was done using biochemical tests and polymerase chain reaction (PCR) method. The antibiotic resistance of the isolates was examined using the Kirby-Bauer disk diffusion method.RESULTS: Based on biochemical tests, out of 270 samples, 82 suspected to have Corynebacterium pseudotuberculosis. Out 82 samples, the presence of bacteria was confirmed in 76 samples by the PCR. The antibiotic sensitivity test showed that the isolates had high sensitivity to doxycycline and ceftriaxone and high resistance to streptomycin and kanamycin.CONCLUSIONS: The CLA has a high prevalence in sheep in Kurdistan province. According to high resistance rate of Corynebacterium pseudotuberculosis to streptomycin and kanamycin, it recommended to avoid treatment of CLA cases with these antibiotics.

BACKGROUND: Cadmium is a heavy metal harmful to animals and humans. Exposure to it causes inflammation, apoptosis, or necrosis in numerous tissues, including the adrenal.OBJECTIVES: The present research investigates the effect of cadmium toxicity on the expression of genes involved in inflammation and fibrosis. Inflammation increases the rate of parenchymal cell death, and fibrosis will only fill the place of dead cells without being able to perform the function of the primary parenchyma.METHODS: In this research, cadmium chloride with a concentration of 20 mg/kg was added to the diet of ten mice in two groups of five. On the 30th day of the study, the adrenal glands were quickly sent to the laboratory. The expression of NF-kB/MAPK, hematoxylin, eosin tissue staining, and immunohistochemistry (CD163) were performed.RESULTS: The inflammation mentioned in others’ research can also be associated with the activation of the nuclear factor kappa (NF-kB) pathway. NF-κB gene products initiate mitogen-activated protein kinase (MAPK) and p38 pathways. Previous studies indicate that MAPK induces necrosis or apoptosis in tissues. In histopathology, dense and possibly pyknosis nuclei are more common in the cadmium group. The higher expression of the CD163 molecule in the cadmium group reveals the beginning of the fibrosis process after chronic inflammation.CONCLUSIONS: This report provides more basic data to investigate the mechanism of adrenal damage in cadmium poisoning. Cadmium causes the death of cells by affecting the inflammatory pathways. Additionally, the stimulation of the fibrosis process causes greater irreparable damage to the damaged tissue of the adrenal gland.