BACKGROUND: Reptiles, especially turtles that inhabit both on land and water, have made some special adaptations. Many people keep turtles as pets. Therefore, the anatomical knowledge of turtles should be more carefully evaluated and used for therapeutic purposes. One of these turtles is European pond turtle (Emys orbicularis). Most of vital systems are enclosed by the carapace and the plastron so it cannot be examined customarily by clinicians. The noninvasive diagnostic imaging techniques provide detailed information concerning these organs. OBJECTIVES: This study was conducted to give complete topographic information and knowledge about the position of the non respiratory organs of the coelomic cavity in the European pond turtle using Computed Tomography (CT) and usual anatomic methods. METHODS: 10 adult turtles (5 female, 5 male) were selected. All scans were obtained on a two detector scanner. In anatomical study three female and three male turtles were dissected. Two other female and male turtles were sectioned transversely. RESULTS: The results showed some differences in the position of the organs including stomach, gall bladder, liver and heart with those of other species. Moreover, the topography of the organs is described in retracted and protruded neck in this article. Retraction of the neck had an influence on the position of the organs such as oesophagus, stomach, liver and heart. CONCLUSIONS: The general morphological features of the non respiratory organs of the coelonic cavity of European pond turtle were examined by CT images and macroscopically in this study. Significant differences were found compared with other species.

BACKGROUND: SDFT, DDFT and suspensory ligament are the most important tendons and ligament of the palmar aspect of the metacarpus that contribute to stability mechanism. OBJECTIVES: The purpose of this study was to describe the tendons and ligaments of the palmar surface of metacarpus in Anatoly donkey and compare them with those in horse. METHODS: 14 healthy Anatoly donkeys without lameness were selected to detect the tendons, ligaments and their accessories on the palmar surface of metacarpus in both left and right forelimbs after euthanasia. 4 horses were also selected and their tendons and ligaments in palmar surface of metacarpus were compared with those in Anatoly donkeys.  RESULTS: DDFT and suspensory ligament in this region were similar in Anatoly donkeys and horses but SDFT in Anatoly donkeys had an accessory ligament in the palmar surface of the metacarpus that was originated from the deep fascia of carp after the carpal joint and was joined to the SDFT. CONCLUSIONS: This second accessory ligament of SDFT has not been observed in the studied horses and has never been reported in the related references. The results of this study can be used in to diagnose and treat lameness in Anatoly donkeys by radiologists and surgeons.

BACKGROUND: Fish are constantly exposed to various pathogens and parasites in particular. Gyrodactylus from Platyhelminthes is an important monogenean ectoparasite that can cause disease and economical losses to cultured, wild, salt and fresh water and ornamental fish. Gyrodactylus appears to be one of the most prevalent parasites of ornamental fish especially in Cyprinids. Objectives: The present study aimed to identify morphometric and molecular characteristics of Gyrodactylus parasite on Carassius auratus (Linnaeus, 1758). Methods: Gyrocactylus parasites were isolated from skin, fins and gills of the fish with wet mount slide and were examined under light microscopy. The morphometrical characterization of Gyrodactylus specimens was performed using the measurements and drawings of opisthaptoral hard parts of the parasites. The molecular species description was based on polymerase chain reaction (PCR) of partial sequence of 5.8S region of ribosomal RNA (5´CGATCATCGGTCTCTCGAAC3´) and partial sequence of internal transcribed spacer2 (ITS2) of ribosomal RNA (5´TTAAGGAAGAACCACTAGAG3´). ResultS: Gyrodactylus species morphology identification was performed using Yamaguti (1961) identification key. The nucleotide sequences of the PCR products were compared with GenBank sequences. Conclusions: Based on morphometric analysis and sequencing, the Gyrodactylus specimens were described as Gyrodactylus kobayashi. Combination of molecular techniques with morphological analysis seems to be the best approach to identification of Gyrodactylus spices.

BACKGROUND: Freshwater pulmonate family Lymnaeidae are well-known for their role in transmission of diginean trematodes worldwide. Objectives: The study was aimed to investigate the ecology and effects of physical and chemical components of the environment on their distribution and populaion density. Methods: The lymnaeid snails were randomly collected from 16 freshwater habitats in West Azarbaijan Province and water samples were also provided from the habitats for chemical analysis. Results: The distribution patterns of the lymnaeid snails in all the examined sites were almost identical throughout the year except in winter. The snails were mostly found in lentic waters or slow-moving streams with muddy beds. The population densities of Lymnaea auricularia, L. gedrosiana and L. stagnalis significantly differed among the investigated waters during the course of study. The concentration of nitrate had significant positive correlations with the snails’ density while there was no significant correlation between nitrite or phosphate concentration with the population density and body size. Conclusions: The results indicated that distribution and density of the snails were affected by season and physicochemical characteristics of environments. These results can be useful for launching the control programs against parasitic trematodes in the region.

BACKGROUND: Sarcocystis infection is one of the most common zoonotic protozoon diseases caused by different Sarcocystis spp. Objectives: Due to the importance of this infection in public health, the infection rate of macroscopic and microscopic cysts in sheep and cattle of abattoir of Shahriar, was investigated. Methods: 138 slaughtered sheep and cattle were selected randomly and their esophagus, diaphragm, heart, tongue, masseter and intercostal muscles were separated. In order to find cysts, the samples were examined by two methods: direct observation for macroscopic cysts and finding microscopics cysts by smear dab, Giemsa staining and microscopic investigation for bradyzoites of parasite. Results: In slaughtered samples, there was no macroscopic cyst but microscopic cysts were positive in 93.48% of cattle and 86.95% of sheep by impression smear method. The results showed the significant difference between different muscles and microscopic cysts (p<0.05) .Heart and esophagus were the most infected and tongue was the least infected part. Infections in males were more than females in both sheep and cattle. There was no significant different in various ages of cattle, however, infection in sheep less than one year old, were higher than the other ages. ConclusionS: Due to the heavy Sarcocystis infection in meat of cattle and sheep and the importance of this parasite in public health, it is suggested to avoid eating raw and undercooked meat and conduct preventive measures such as closer inspection of carcasses and local or total removal of slaughtered in abattoir.

BACKGROUND: Enhancement of the immune system seems to be the most promising method of preventing fish diseases and increasing growth rate. Objectives: The purpose of the present study was to investigate the influence of dietary administration of Zataria multiflora Boiss and Menthapulegium L extracts on phagocytosis, lysozyme, respiratory burst and total white and red blood cells (WBC/RBC) of rainbow trout (Oncorhynchus mykiss). Methods: Two hundred and ten fish (100±10 g) were used in a completely randomized design with 7 treatment and 3 replicates in a 2 weeks period (from 0 to 14 d). The basal diet supplemented with 0 (control), 20, 50 and 100 mg/kg food Z. multiflora and M.pulegium extracts. At the end of the experiment (after 14 days), samples from kidney and blood of the fish were collected in order to determine WBC/RBC (by neubauer chamber), serum lysozyme activity (by turbid metric assay, phagocytosic (by number of yeast cells phagocytosed method) and respiratory burst activities (by reduction of nitroblue tetrazolium method) of head kidney tissue. Results: The results indicated that the highest ratio of phagocytosis and respiratory burst activity was observed in 50 mg/kg extract concentration of Z. multiflora (p<0.05). The highest WBC lysozyme activities were seen   in 100 mg/ kg extract concentration of Z. multiflora. No significant difference was shown between RBC in treatment groups and control group (p>0.05). The highest ratio of phagocytosis activity was observed in 100 mg/kg extract concentration of M. pulegium (p<0.05). No significant difference was observed between WBC /RBC, lysozyme, respiratory burst means in treatment groups and control group (p>0.05). Conclusions: It can be concluded that 50 and 100 mg/ kg of the methanol Z. multiflora and 100 mg/ kg M. pulegium have positive effects on stimulating of innate immune system in O.mykiss, but the influence of Z. multiflora extract with100 mg/ kg  concentration is  better than  M. pulegium extract.

BACKGROUND: The repetitive use of antibiotics in different fields (veterinary and medicine) improves the emergence and occurrence of the resistance phenomenon in pathogenic bacteria. Due to the problem of antimicrobial resistance, it is an urgent need to discover new drugs and alternative treatments for the control of bacterial diseases in aquaculture. OBJECTIVES: The purpose of this study is to investigate antibacterial effects of methanol and hexane extracts of medicinal plants Rattles (Prosopis farcta), datura (Datura stramunium L) and milkweed (Calotropis procera L), the major pathogenic bacteria of fish, including Aeromonas hydrophila, Yersinia ruckeri and Streptococcus iniae. METHODS: Extraction was performed using a rotary evaporator. To determine the minimum inhibitory concentration (MIC), the standard microdilution method (Dilution in broth) was used and the minimum bactericidal concentration (MBC) was determined based on MIC values obtained for each extract. RESULTS: The results showed that the effect of most potent extract, methanol extract obtained from fruit rattle on the three studied bacteria, with MIC and MBC are 25, 50mg/ml, respectively. The most sensitive bacteria to methanol and hexane plant extracts, is bacterium Streptococcus iniae and Aeromonas hydrophila and Yersiniaruckeri bacteria were resistant. The studied extracts had stronger antibacterial properties against gram-positive bacteria compared to gram-negative. CONCLUSIONS: According to the results, it seems that the use of methanol extract of Prosopis farcta fruit is effective for treatment of bacterial diseases in aquaculture.

BACKGROUND: Infectious bronchitis is a highly contagious disease which may cause poor weight gain and low feed efficiency in infected chickens. There are a large number of reported serotypes/genotypes, which makes the control of the disease more difficult through vaccination. However, there are only a few amino acid differences in the S1 protein of vaccine and wild type strains which are responsible for protection. OBJECTIVES: The purpose of this study is to compare IBV variants isolated from commercial chicken flocks in Iran with currently used vaccine strains. METHODES: The partial S1 gene of the spike protein, covering a hypervariable and constant regions, was amplified and sequenced using conventional RT-PCR. RESULTS: Phylogenetic analysis of amino acid sequences revealed that eight of total nine isolates were divergence at least 21.8% from vaccinal Massachusetts serotypes, and six of nine isolates were divergence at least 22.7% from 4/91, and none of the nine isolates were similar to Dutch-type, D274,vaccine serotypes. CONCLUSIONS: These findings are essential for continuous surveillance disease control strategies and monitoring of variants, and thus emphasize on the importance of improving the vaccination program in Iran.

BACKGROUND: Faba bean (Vicia faba) is a rich source of protein and carbohydrates that is used as a vegetable ingredient in diet of livestock, poultry and fish, in many countries. Objectives: This study was conducted to assess the effects of different levels of faba bean on the serum lipid levels and liver function of farmed beluga sturgeon (Huso huso). Methods: 144 juvenile beluga (82.38 ± 0.83 g) were located into 18 oval tanks (300 L) and triplicate groups were fed by experimental diets inclusion 6 levels of faba bean (0, 5, 10, 15, 20 and 25%) for 50 days. At the end of the trial, blood samples were taken from the caudal vein of 54 beluga juveniles and some of biochemical parameters (cholesterol and triglycerides) and liver enzymes such as Alkaline Phosphatase (ALP), Aspartate Aminotransferase (AST), Alanine Aminotransferase (ALT) and Lactate Dehydrogenase (LDH) were investigated. Then nine fish per treatment were sampled to measure Hepatosomatic index (HSI) and liver composition per each treatment. Results: The results showed that by increasing the levels of faba bean in diets ALP, AST and LDH contents were significantly decreased compared to the control treatment (p<0.05). However, the lowest level of ALT (0.76±0.2 U/l) was measured in fish fed with 10% faba bean meal (p<0.05). The moisture and fat contents of liver showed significant difference by increasing the levels of faba bean in diet (p<0.05). No significant differences were shown in cholesterol, triglyceride, HSI, liver protein and liver ash contents (p>0.05). Highly significant positive correlation were observed between total protein, cholesterol, AST, LDH, ALP and liver fat (p<0.01).  Conclusions:  Use of lower levels of faba bean (up to 25%) had no significant effect on serum lipids and no adverse effect on liver function of juvenile beluga.

BACKGROUND: Vitamin C is one of the important nutrients in fish culture and as a potent anti-oxidant, is of great importance in preserving cells against oxidation and boosting resistance in stress conditions and against pathogens. OBJECTIVES: The purpose of the present study is to add high level of vitamin C supplementation to rainbow trout (Oncorhynchus mykiss) diet reared at high density and analysis of growth indices, survival and carcass composition at two different stocking densities. METHODS: Rainbow trout juveniles with initial body weight of 9.6 ± 0.69 g at two densities of 50 and 100 pieces in 50 liters of water were fed two diets containing the same level of protein and fat. Experimental diets were diet 1 without adding vitamin and diet 2 with adding 1500 mg/kg of vitamin C. A total number of 900 rainbow trout juveniles in four treatments each with three replicates as T50 (0) (with the density of 50 and fed with diet 1), T100 (0) (with the density of 100 and fed with diet 1), T50 (C) (with the density of 50 and fed with diet 2) and T100 (C) (with the density of 100 and fed with diet 2) were randomly distributed in incubators. RESULTS: After 6 weeks of feeding, growth indices, feed conversion ratio and viability were significantly different between treatments (p<0.05). T50 (0) and T50(C) treatments had higher weight gain, specific growth rate and viability than T100 (0) and T100(C) (p<0.05). In the case of feed conversion ratio, it was higher in T100 (0) and T100(C) treatments compared to T50 (0) and T50(C) ones (p<0.05). Carcass composition was not significantly different between treatments (p>0.05). CONCLUSIONS: The results showed that vitamin C supplementation in the diet of rainbow trout juveniles did not have significant effects on growth indices, feed conversion ratio, survival and carcass composition but density was a key factor in growth, feed conversion ratio and survival in this species.